Multiple sequence alignment - TraesCS4A01G285200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G285200 chr4A 100.000 3398 0 0 1 3398 591507137 591510534 0.000000e+00 6276.0
1 TraesCS4A01G285200 chr4A 98.911 3399 15 3 1 3398 592536550 592533173 0.000000e+00 6052.0
2 TraesCS4A01G285200 chr4A 98.790 3306 18 3 94 3398 592822804 592819520 0.000000e+00 5864.0
3 TraesCS4A01G285200 chr4A 100.000 642 0 0 1885 2526 593100809 593100168 0.000000e+00 1186.0
4 TraesCS4A01G285200 chr4A 99.370 635 1 1 1 635 593105094 593104463 0.000000e+00 1147.0
5 TraesCS4A01G285200 chr4A 81.728 301 41 10 2772 3068 665472335 665472045 4.380000e-59 239.0
6 TraesCS4A01G285200 chrUn 97.624 1515 14 3 1885 3398 360832969 360831476 0.000000e+00 2579.0
7 TraesCS4A01G285200 chr4D 91.988 1348 81 14 1063 2392 10770286 10768948 0.000000e+00 1866.0
8 TraesCS4A01G285200 chr4D 91.960 199 11 4 3205 3398 10772594 10772792 1.200000e-69 274.0
9 TraesCS4A01G285200 chr6B 88.985 1507 121 28 916 2392 698047854 698046363 0.000000e+00 1821.0
10 TraesCS4A01G285200 chr6B 81.560 282 43 7 2778 3056 45162783 45162508 1.230000e-54 224.0
11 TraesCS4A01G285200 chr4B 89.632 1360 105 18 1053 2392 20306749 20305406 0.000000e+00 1698.0
12 TraesCS4A01G285200 chr4B 92.857 154 11 0 1 154 549133863 549133710 1.230000e-54 224.0
13 TraesCS4A01G285200 chr4B 80.000 140 14 10 3205 3341 20307879 20308007 1.300000e-14 91.6
14 TraesCS4A01G285200 chr7B 93.464 153 9 1 1 152 185623043 185622891 3.410000e-55 226.0
15 TraesCS4A01G285200 chr7B 93.421 152 9 1 1 151 678205587 678205436 1.230000e-54 224.0
16 TraesCS4A01G285200 chr7B 79.935 309 51 8 2773 3078 31556008 31556308 2.050000e-52 217.0
17 TraesCS4A01G285200 chr5D 93.960 149 9 0 1 149 66671802 66671950 3.410000e-55 226.0
18 TraesCS4A01G285200 chr6D 92.357 157 12 0 1 157 469057613 469057457 1.230000e-54 224.0
19 TraesCS4A01G285200 chr5B 80.259 309 50 8 2773 3078 577101490 577101190 4.410000e-54 222.0
20 TraesCS4A01G285200 chr5B 80.198 303 47 9 2773 3072 671201274 671200982 7.380000e-52 215.0
21 TraesCS4A01G285200 chr3D 89.773 176 15 3 1 174 142632557 142632731 4.410000e-54 222.0
22 TraesCS4A01G285200 chr3D 79.935 309 51 8 2773 3078 553333911 553333611 2.050000e-52 217.0
23 TraesCS4A01G285200 chr1B 91.304 161 14 0 1 161 268402846 268402686 1.590000e-53 220.0
24 TraesCS4A01G285200 chr7D 85.517 145 20 1 2514 2658 191163005 191162862 2.110000e-32 150.0
25 TraesCS4A01G285200 chr7A 76.216 185 43 1 2514 2698 199096748 199096931 2.790000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G285200 chr4A 591507137 591510534 3397 False 6276.0 6276 100.000 1 3398 1 chr4A.!!$F1 3397
1 TraesCS4A01G285200 chr4A 592533173 592536550 3377 True 6052.0 6052 98.911 1 3398 1 chr4A.!!$R1 3397
2 TraesCS4A01G285200 chr4A 592819520 592822804 3284 True 5864.0 5864 98.790 94 3398 1 chr4A.!!$R2 3304
3 TraesCS4A01G285200 chr4A 593100168 593105094 4926 True 1166.5 1186 99.685 1 2526 2 chr4A.!!$R4 2525
4 TraesCS4A01G285200 chrUn 360831476 360832969 1493 True 2579.0 2579 97.624 1885 3398 1 chrUn.!!$R1 1513
5 TraesCS4A01G285200 chr4D 10768948 10770286 1338 True 1866.0 1866 91.988 1063 2392 1 chr4D.!!$R1 1329
6 TraesCS4A01G285200 chr6B 698046363 698047854 1491 True 1821.0 1821 88.985 916 2392 1 chr6B.!!$R2 1476
7 TraesCS4A01G285200 chr4B 20305406 20306749 1343 True 1698.0 1698 89.632 1053 2392 1 chr4B.!!$R1 1339

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
395 396 1.154225 CGCATCGTTGTTTCCCTGC 60.154 57.895 0.0 0.0 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2526 4934 6.049149 TGAGAGGTCGTTTGATATCCAAATC 58.951 40.0 0.0 0.0 45.48 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
395 396 1.154225 CGCATCGTTGTTTCCCTGC 60.154 57.895 0.00 0.0 0.00 4.85
2526 4934 4.353737 TGTAGTGCCGCTATAGTTTAACG 58.646 43.478 0.84 0.0 31.50 3.18
2549 4957 5.175856 CGATTTGGATATCAAACGACCTCTC 59.824 44.000 4.83 0.0 46.72 3.20
2613 5021 3.541632 AGACCACACGTCAACTTTCAAT 58.458 40.909 0.00 0.0 44.66 2.57
2643 5051 6.222389 TCGAAGACGTTTTATTCCCACTTAA 58.778 36.000 0.00 0.0 40.69 1.85
2714 5122 0.590481 GAACGGGCAACAACGTCAAC 60.590 55.000 0.00 0.0 43.31 3.18
2719 5128 3.027292 CAACAACGTCAACGGGGG 58.973 61.111 7.53 0.0 44.95 5.40
2746 5155 3.000925 CGGCAACTATGAACGTATCCAAC 59.999 47.826 0.00 0.0 0.00 3.77
2840 5249 1.542915 CCACCGAAACGAGGACTAGAA 59.457 52.381 0.00 0.0 0.00 2.10
3005 5414 2.372172 CCTAATTAAGGCCACCGGAGAT 59.628 50.000 9.46 0.0 38.97 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2526 4934 6.049149 TGAGAGGTCGTTTGATATCCAAATC 58.951 40.000 0.00 0.00 45.48 2.17
2549 4957 5.299622 CGTTTGTCAAATTTCATCGCATTG 58.700 37.500 0.40 0.00 0.00 2.82
2613 5021 5.122711 GGGAATAAAACGTCTTCGAAATGGA 59.877 40.000 0.00 0.00 40.62 3.41
2664 5072 4.041917 ATTTGCACGTGCCTGCGG 62.042 61.111 35.72 0.00 40.31 5.69
2665 5073 2.801996 CATTTGCACGTGCCTGCG 60.802 61.111 35.72 18.94 40.31 5.18
2666 5074 2.017783 CACATTTGCACGTGCCTGC 61.018 57.895 35.72 13.65 41.18 4.85
2667 5075 1.372004 CCACATTTGCACGTGCCTG 60.372 57.895 35.72 29.27 41.18 4.85
2668 5076 0.895100 ATCCACATTTGCACGTGCCT 60.895 50.000 35.72 18.80 41.18 4.75
2669 5077 0.733566 CATCCACATTTGCACGTGCC 60.734 55.000 35.72 19.24 41.18 5.01
2670 5078 0.733566 CCATCCACATTTGCACGTGC 60.734 55.000 33.11 33.11 42.50 5.34
2671 5079 0.597568 ACCATCCACATTTGCACGTG 59.402 50.000 12.28 12.28 0.00 4.49
2672 5080 0.881118 GACCATCCACATTTGCACGT 59.119 50.000 0.00 0.00 0.00 4.49
2673 5081 1.131126 GAGACCATCCACATTTGCACG 59.869 52.381 0.00 0.00 0.00 5.34
2719 5128 0.725117 CGTTCATAGTTGCCGGTTCC 59.275 55.000 1.90 0.00 0.00 3.62
2747 5156 1.829222 TCATAGTTGTCGGTTCTCCCC 59.171 52.381 0.00 0.00 0.00 4.81
2748 5157 3.259902 GTTCATAGTTGTCGGTTCTCCC 58.740 50.000 0.00 0.00 0.00 4.30
2749 5158 2.921754 CGTTCATAGTTGTCGGTTCTCC 59.078 50.000 0.00 0.00 0.00 3.71
2750 5159 3.572584 ACGTTCATAGTTGTCGGTTCTC 58.427 45.455 0.00 0.00 0.00 2.87
2751 5160 3.655276 ACGTTCATAGTTGTCGGTTCT 57.345 42.857 0.00 0.00 0.00 3.01
2752 5161 4.501921 GGATACGTTCATAGTTGTCGGTTC 59.498 45.833 0.00 0.00 0.00 3.62
2753 5162 4.159135 AGGATACGTTCATAGTTGTCGGTT 59.841 41.667 0.00 0.00 46.39 4.44
2794 5203 3.118454 GCATCGTCGGTGGGTGTG 61.118 66.667 7.76 0.00 0.00 3.82
2840 5249 6.985225 TGAAGATGGAATAAAATTCTCCCCT 58.015 36.000 0.11 0.00 0.00 4.79
2896 5305 4.994907 AGTTTTGTTAGGGTTTGTGTCC 57.005 40.909 0.00 0.00 0.00 4.02
2961 5370 2.971330 CCATAAGAGCAGAGTGGATCCT 59.029 50.000 14.23 0.00 31.59 3.24
3005 5414 2.872557 CCGCCGTCAGTTCGTCTA 59.127 61.111 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.