Multiple sequence alignment - TraesCS4A01G285000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G285000 chr4A 100.000 2697 0 0 1 2697 591346606 591349302 0 4981
1 TraesCS4A01G285000 chr4A 98.702 2697 31 4 1 2697 591416125 591418817 0 4783
2 TraesCS4A01G285000 chr4A 97.924 2698 55 1 1 2697 592362838 592360141 0 4671
3 TraesCS4A01G285000 chr4A 97.480 2698 65 3 1 2697 591292840 591295535 0 4602
4 TraesCS4A01G285000 chr4A 97.294 2698 71 2 1 2697 591674110 591676806 0 4577
5 TraesCS4A01G285000 chr4A 97.041 2704 72 2 1 2697 592336516 592333814 0 4543
6 TraesCS4A01G285000 chr4A 98.537 1777 26 0 1 1777 592928170 592926394 0 3138
7 TraesCS4A01G285000 chr4A 98.222 1687 29 1 1 1687 592310559 592308874 0 2948
8 TraesCS4A01G285000 chr4A 98.044 1687 33 0 1 1687 591285311 591283625 0 2933
9 TraesCS4A01G285000 chr4A 98.625 1382 19 0 1316 2697 592926383 592925002 0 2447
10 TraesCS4A01G285000 chr4A 98.486 925 14 0 1773 2697 592636718 592635794 0 1631
11 TraesCS4A01G285000 chr4A 98.056 926 18 0 1772 2697 592308466 592307541 0 1611
12 TraesCS4A01G285000 chr4A 98.033 915 18 0 1783 2697 591283300 591282386 0 1591
13 TraesCS4A01G285000 chr4D 91.100 1573 117 11 182 1736 10810819 10812386 0 2108


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G285000 chr4A 591346606 591349302 2696 False 4981.0 4981 100.0000 1 2697 1 chr4A.!!$F2 2696
1 TraesCS4A01G285000 chr4A 591416125 591418817 2692 False 4783.0 4783 98.7020 1 2697 1 chr4A.!!$F3 2696
2 TraesCS4A01G285000 chr4A 592360141 592362838 2697 True 4671.0 4671 97.9240 1 2697 1 chr4A.!!$R2 2696
3 TraesCS4A01G285000 chr4A 591292840 591295535 2695 False 4602.0 4602 97.4800 1 2697 1 chr4A.!!$F1 2696
4 TraesCS4A01G285000 chr4A 591674110 591676806 2696 False 4577.0 4577 97.2940 1 2697 1 chr4A.!!$F4 2696
5 TraesCS4A01G285000 chr4A 592333814 592336516 2702 True 4543.0 4543 97.0410 1 2697 1 chr4A.!!$R1 2696
6 TraesCS4A01G285000 chr4A 592925002 592928170 3168 True 2792.5 3138 98.5810 1 2697 2 chr4A.!!$R6 2696
7 TraesCS4A01G285000 chr4A 592307541 592310559 3018 True 2279.5 2948 98.1390 1 2697 2 chr4A.!!$R5 2696
8 TraesCS4A01G285000 chr4A 591282386 591285311 2925 True 2262.0 2933 98.0385 1 2697 2 chr4A.!!$R4 2696
9 TraesCS4A01G285000 chr4A 592635794 592636718 924 True 1631.0 1631 98.4860 1773 2697 1 chr4A.!!$R3 924
10 TraesCS4A01G285000 chr4D 10810819 10812386 1567 False 2108.0 2108 91.1000 182 1736 1 chr4D.!!$F1 1554

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
754 770 2.436646 CATCCTCACACCGCACCC 60.437 66.667 0.0 0.0 0.0 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2585 3082 0.243907 AACGTACTGCAGTGCTCGAT 59.756 50.0 31.44 23.22 0.0 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 230 8.536340 TTTTAAAAGCCAAGTACTTCCCTAAA 57.464 30.769 4.77 2.24 0.00 1.85
485 491 4.845030 GGCCCCTCCCTTACCTTA 57.155 61.111 0.00 0.00 0.00 2.69
513 521 2.745102 TCACATCTTCGCACGTTGTTA 58.255 42.857 0.00 0.00 0.00 2.41
754 770 2.436646 CATCCTCACACCGCACCC 60.437 66.667 0.00 0.00 0.00 4.61
1448 1464 0.178992 CAAGTTTGTCCCTGCCCTCA 60.179 55.000 0.00 0.00 0.00 3.86
1928 2425 1.001860 CCAATTTTGGCCCATGTTCGT 59.998 47.619 0.00 0.00 42.21 3.85
2324 2821 6.208644 ACTTTCCACATTTGATCTTTCAACG 58.791 36.000 0.00 0.00 41.50 4.10
2585 3082 3.668447 TCAACAAGCTTGGCAAAAACAA 58.332 36.364 29.18 2.67 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
480 486 5.118990 CGAAGATGTGATTGGACATAAGGT 58.881 41.667 0.00 0.00 36.67 3.50
484 490 3.871006 GTGCGAAGATGTGATTGGACATA 59.129 43.478 0.00 0.00 36.67 2.29
485 491 2.679837 GTGCGAAGATGTGATTGGACAT 59.320 45.455 0.00 0.00 39.34 3.06
754 770 3.566322 CACTACGTAGGAGGAGAGATTGG 59.434 52.174 25.63 0.00 0.00 3.16
1215 1231 0.249615 CAGGATGCCGACGATGATGT 60.250 55.000 0.00 0.00 0.00 3.06
1448 1464 0.038159 CTCTTCTTGACGGCGGACTT 60.038 55.000 13.24 0.00 0.00 3.01
1592 1617 1.974236 AGCTCAGACTTTGTAGCCACT 59.026 47.619 0.00 0.00 33.27 4.00
1928 2425 5.551233 TGTTCAATTTGTTCCAAACCACAA 58.449 33.333 0.00 0.00 0.00 3.33
2324 2821 2.424733 GGTACCCCGCTCTGACCTC 61.425 68.421 0.00 0.00 0.00 3.85
2585 3082 0.243907 AACGTACTGCAGTGCTCGAT 59.756 50.000 31.44 23.22 0.00 3.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.