Multiple sequence alignment - TraesCS4A01G284900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G284900 chr4A 100.000 2798 0 0 1 2798 591292757 591295554 0.000000e+00 5168
1 TraesCS4A01G284900 chr4A 97.647 2805 59 2 1 2798 592336599 592333795 0.000000e+00 4807
2 TraesCS4A01G284900 chr4A 97.571 2800 65 3 1 2798 591346523 591349321 0.000000e+00 4791
3 TraesCS4A01G284900 chr4A 97.464 2800 64 6 1 2798 591416042 591418836 0.000000e+00 4771
4 TraesCS4A01G284900 chr4A 97.286 2800 73 3 1 2798 591674027 591676825 0.000000e+00 4747
5 TraesCS4A01G284900 chr4A 96.965 2801 81 4 1 2798 592362921 592360122 0.000000e+00 4698
6 TraesCS4A01G284900 chr4A 97.849 1860 38 2 1 1858 592928253 592926394 0.000000e+00 3212
7 TraesCS4A01G284900 chr4A 97.571 1770 40 3 1 1768 592310642 592308874 0.000000e+00 3027
8 TraesCS4A01G284900 chr4A 97.345 1770 45 2 1 1768 591285394 591283625 0.000000e+00 3007
9 TraesCS4A01G284900 chr4A 97.004 1402 41 1 1397 2798 592926383 592924983 0.000000e+00 2355
10 TraesCS4A01G284900 chr4A 97.249 945 25 1 1854 2798 592636718 592635775 0.000000e+00 1600
11 TraesCS4A01G284900 chr4A 96.723 946 31 0 1853 2798 592308467 592307522 0.000000e+00 1576
12 TraesCS4A01G284900 chr4A 97.002 934 28 0 1865 2798 591283300 591282367 0.000000e+00 1570
13 TraesCS4A01G284900 chr4A 85.745 470 57 6 3 466 32715571 32715106 3.240000e-134 488
14 TraesCS4A01G284900 chr4D 90.909 1573 118 13 265 1817 10828588 10830155 0.000000e+00 2089


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G284900 chr4A 591292757 591295554 2797 False 5168.0 5168 100.0000 1 2798 1 chr4A.!!$F1 2797
1 TraesCS4A01G284900 chr4A 592333795 592336599 2804 True 4807.0 4807 97.6470 1 2798 1 chr4A.!!$R2 2797
2 TraesCS4A01G284900 chr4A 591346523 591349321 2798 False 4791.0 4791 97.5710 1 2798 1 chr4A.!!$F2 2797
3 TraesCS4A01G284900 chr4A 591416042 591418836 2794 False 4771.0 4771 97.4640 1 2798 1 chr4A.!!$F3 2797
4 TraesCS4A01G284900 chr4A 591674027 591676825 2798 False 4747.0 4747 97.2860 1 2798 1 chr4A.!!$F4 2797
5 TraesCS4A01G284900 chr4A 592360122 592362921 2799 True 4698.0 4698 96.9650 1 2798 1 chr4A.!!$R3 2797
6 TraesCS4A01G284900 chr4A 592924983 592928253 3270 True 2783.5 3212 97.4265 1 2798 2 chr4A.!!$R7 2797
7 TraesCS4A01G284900 chr4A 592307522 592310642 3120 True 2301.5 3027 97.1470 1 2798 2 chr4A.!!$R6 2797
8 TraesCS4A01G284900 chr4A 591282367 591285394 3027 True 2288.5 3007 97.1735 1 2798 2 chr4A.!!$R5 2797
9 TraesCS4A01G284900 chr4A 592635775 592636718 943 True 1600.0 1600 97.2490 1854 2798 1 chr4A.!!$R4 944
10 TraesCS4A01G284900 chr4D 10828588 10830155 1567 False 2089.0 2089 90.9090 265 1817 1 chr4D.!!$F1 1552

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
774 788 1.749033 GGTAATCTCTCCGGGCCTG 59.251 63.158 3.88 3.88 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2624 3120 0.036388 GTCATGCTCCTCCGGTGAAA 60.036 55.0 4.76 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
482 484 3.631250 ACCCCGAAAATGCTACATTCAT 58.369 40.909 0.00 0.00 0.00 2.57
774 788 1.749033 GGTAATCTCTCCGGGCCTG 59.251 63.158 3.88 3.88 0.00 4.85
1403 1418 3.642778 GACGCCGCCTTCAGCACTA 62.643 63.158 0.00 0.00 44.04 2.74
1553 1568 0.109272 CGCCGTCAAGAAGAGCTACA 60.109 55.000 0.00 0.00 0.00 2.74
1588 1603 1.299976 GAATCCCCAGGACAAGCGT 59.700 57.895 0.00 0.00 32.98 5.07
1757 1781 0.889994 TACGTTACTGTGGCGGTGAT 59.110 50.000 0.00 0.00 0.00 3.06
1873 2369 3.207452 CCCCTGGGGCTTGAAATAC 57.793 57.895 21.20 0.00 35.35 1.89
1875 2371 0.631212 CCCTGGGGCTTGAAATACCT 59.369 55.000 4.27 0.00 0.00 3.08
2584 3080 3.369175 TCGGATAGATGCCATCTGCTAT 58.631 45.455 17.46 2.74 40.51 2.97
2607 3103 5.088730 TGTAGTATCCCTTGTTGTAGTGGT 58.911 41.667 0.00 0.00 0.00 4.16
2624 3120 1.203162 TGGTGCCCATTGACCTTGAAT 60.203 47.619 0.00 0.00 32.98 2.57
2725 3221 3.134458 CTGGCATACCGAAGAAGGATTC 58.866 50.000 0.00 0.00 42.42 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
482 484 2.160721 ATTCTCTTCGTAGGAGCCCA 57.839 50.000 0.00 0.00 0.00 5.36
736 750 0.746659 GCGCCCAAATTAGCAATCCT 59.253 50.000 0.00 0.00 0.00 3.24
774 788 2.431942 ATCGACCCGCACGTTGAC 60.432 61.111 0.00 0.00 0.00 3.18
817 831 1.221840 GGTGCGGTGTGAGGATGAT 59.778 57.895 0.00 0.00 0.00 2.45
1553 1568 0.841289 TTCCTGGGAAGAAACGTGGT 59.159 50.000 0.00 0.00 0.00 4.16
1588 1603 3.447229 TCAGGAATGACTCAATGAGCGTA 59.553 43.478 10.62 0.00 32.04 4.42
1831 1855 1.953686 AGAACGGCTAGAGATGCTCTC 59.046 52.381 0.00 5.36 43.70 3.20
1859 2355 0.254747 CGGAGGTATTTCAAGCCCCA 59.745 55.000 0.00 0.00 0.00 4.96
2141 2637 0.978146 AGGGCAACACCTAGCTCGAT 60.978 55.000 0.00 0.00 39.65 3.59
2439 2935 2.229792 GTTTGGTGTGCTCCAATCTCA 58.770 47.619 6.56 0.00 45.30 3.27
2584 3080 5.046878 CACCACTACAACAAGGGATACTACA 60.047 44.000 0.00 0.00 0.00 2.74
2607 3103 3.006752 GTGAAATTCAAGGTCAATGGGCA 59.993 43.478 0.00 0.00 0.00 5.36
2624 3120 0.036388 GTCATGCTCCTCCGGTGAAA 60.036 55.000 4.76 0.00 0.00 2.69
2725 3221 4.265073 CAAACAGGACCTCTAGATTTGGG 58.735 47.826 0.00 0.00 0.00 4.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.