Multiple sequence alignment - TraesCS4A01G284800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G284800 chr4A 100.000 1942 0 0 1 1942 591285566 591283625 0 3587
1 TraesCS4A01G284800 chr4A 97.890 1943 40 1 1 1942 592928426 592926484 0 3360
2 TraesCS4A01G284800 chr4A 97.787 1943 42 1 1 1942 591346350 591348292 0 3349
3 TraesCS4A01G284800 chr4A 97.787 1943 41 2 1 1942 592310815 592308874 0 3349
4 TraesCS4A01G284800 chr4A 97.633 1943 43 2 1 1942 591415869 591417809 0 3330
5 TraesCS4A01G284800 chr4A 97.479 1944 47 2 1 1942 592363094 592361151 0 3317
6 TraesCS4A01G284800 chr4A 97.221 1943 51 3 1 1942 591292584 591294524 0 3286
7 TraesCS4A01G284800 chr4A 97.015 1943 57 1 1 1942 591673854 591675796 0 3265
8 TraesCS4A01G284800 chr4A 96.655 1943 63 2 1 1942 592336772 592334831 0 3227
9 TraesCS4A01G284800 chr4A 97.614 1383 32 1 1 1382 592639042 592637660 0 2370
10 TraesCS4A01G284800 chr4A 100.000 519 0 0 2267 2785 591283300 591282782 0 959
11 TraesCS4A01G284800 chr4A 98.073 519 10 0 2267 2785 591348388 591348906 0 904
12 TraesCS4A01G284800 chr4A 98.073 519 10 0 2267 2785 592636708 592636190 0 904
13 TraesCS4A01G284800 chr4A 97.881 519 11 0 2267 2785 592925916 592925398 0 898
14 TraesCS4A01G284800 chr4A 97.495 519 13 0 2267 2785 591294621 591295139 0 887
15 TraesCS4A01G284800 chr4A 97.495 519 13 0 2267 2785 592308455 592307937 0 887
16 TraesCS4A01G284800 chr4A 97.303 519 12 2 2267 2785 591417905 591418421 0 880
17 TraesCS4A01G284800 chr4A 96.917 519 16 0 2267 2785 592334728 592334210 0 870
18 TraesCS4A01G284800 chr4A 96.917 519 16 0 2267 2785 592361055 592360537 0 870
19 TraesCS4A01G284800 chr4A 96.917 519 15 1 2267 2785 591675893 591676410 0 869
20 TraesCS4A01G284800 chr4D 88.724 1685 137 27 276 1942 10828457 10830106 0 2010


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G284800 chr4A 591282782 591285566 2784 True 2273.0 3587 100.0000 1 2785 2 chr4A.!!$R1 2784
1 TraesCS4A01G284800 chr4A 592925398 592928426 3028 True 2129.0 3360 97.8855 1 2785 2 chr4A.!!$R6 2784
2 TraesCS4A01G284800 chr4A 591346350 591348906 2556 False 2126.5 3349 97.9300 1 2785 2 chr4A.!!$F2 2784
3 TraesCS4A01G284800 chr4A 592307937 592310815 2878 True 2118.0 3349 97.6410 1 2785 2 chr4A.!!$R2 2784
4 TraesCS4A01G284800 chr4A 591415869 591418421 2552 False 2105.0 3330 97.4680 1 2785 2 chr4A.!!$F3 2784
5 TraesCS4A01G284800 chr4A 592360537 592363094 2557 True 2093.5 3317 97.1980 1 2785 2 chr4A.!!$R4 2784
6 TraesCS4A01G284800 chr4A 591292584 591295139 2555 False 2086.5 3286 97.3580 1 2785 2 chr4A.!!$F1 2784
7 TraesCS4A01G284800 chr4A 591673854 591676410 2556 False 2067.0 3265 96.9660 1 2785 2 chr4A.!!$F4 2784
8 TraesCS4A01G284800 chr4A 592334210 592336772 2562 True 2048.5 3227 96.7860 1 2785 2 chr4A.!!$R3 2784
9 TraesCS4A01G284800 chr4A 592636190 592639042 2852 True 1637.0 2370 97.8435 1 2785 2 chr4A.!!$R5 2784
10 TraesCS4A01G284800 chr4D 10828457 10830106 1649 False 2010.0 2010 88.7240 276 1942 1 chr4D.!!$F1 1666

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
929 946 0.249447 GGATTGCTAATTTGGGCGCC 60.249 55.0 21.18 21.18 0.0 6.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2545 2822 2.832129 CTCAAGGGTAACACCTAGCTCA 59.168 50.0 0.0 0.0 40.87 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
323 325 8.788238 AGGATAATAAAAAGATGGATTGGCTT 57.212 30.769 0.00 0.00 0.00 4.35
371 373 3.572661 AGTGAAGGGGGTAAGGACTTA 57.427 47.619 0.00 0.00 0.00 2.24
588 590 8.613923 TCAAGCATGGATATATTTGGAGGATTA 58.386 33.333 0.00 0.00 0.00 1.75
929 946 0.249447 GGATTGCTAATTTGGGCGCC 60.249 55.000 21.18 21.18 0.00 6.53
1011 1028 2.217038 ATCCTCACACCGCACCACT 61.217 57.895 0.00 0.00 0.00 4.00
1022 1039 0.309302 CGCACCACTATCTCTCCTCG 59.691 60.000 0.00 0.00 0.00 4.63
1288 1306 3.117888 TGGACAAGGGCAAGATATTCCTC 60.118 47.826 0.00 0.00 0.00 3.71
1387 1405 1.216710 CAGGGTCGGCTTCACTCTC 59.783 63.158 0.00 0.00 0.00 3.20
1684 1702 1.070134 GGTGATGCATACGAGGCCTAA 59.930 52.381 4.42 0.00 0.00 2.69
2333 2610 2.666098 GGGCTCGGGTTTCCAGCTA 61.666 63.158 0.00 0.00 37.36 3.32
2558 2835 4.882842 TCACATGTTGAGCTAGGTGTTA 57.117 40.909 0.00 0.00 0.00 2.41
2669 2946 1.229082 AGACCAGGTTGCCGGTAGA 60.229 57.895 1.90 0.00 32.44 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 118 2.379634 GCCGACGCCCAAAAATTGC 61.380 57.895 0.00 0.0 0.00 3.56
118 120 2.257067 CGCCGACGCCCAAAAATT 59.743 55.556 0.00 0.0 0.00 1.82
323 325 2.885135 AGAGAATTGTCCACCATGCA 57.115 45.000 0.00 0.0 0.00 3.96
929 946 0.824182 AGAGGCCCGGAGAGATTACG 60.824 60.000 0.73 0.0 0.00 3.18
1011 1028 4.366586 CACACTACGTACGAGGAGAGATA 58.633 47.826 24.41 0.0 0.00 1.98
1022 1039 2.032636 GGTTGGTTTGCACACTACGTAC 60.033 50.000 2.52 0.0 0.00 3.67
1288 1306 1.800805 AGATCTGCACGAAGGTGTTG 58.199 50.000 0.00 0.0 46.13 3.33
1622 1640 1.134848 GCTGAAGGCAGAGTCGAAGAT 60.135 52.381 0.00 0.0 45.17 2.40
1643 1661 0.107459 GTGGTCTCCTTGATGGCCTC 60.107 60.000 3.32 0.0 35.26 4.70
1684 1702 0.537371 CGAGGGCAGGGACAAACTTT 60.537 55.000 0.00 0.0 0.00 2.66
2545 2822 2.832129 CTCAAGGGTAACACCTAGCTCA 59.168 50.000 0.00 0.0 40.87 4.26
2669 2946 3.499338 TCTTGCCAAAGTTGATCACCAT 58.501 40.909 0.00 0.0 34.78 3.55
2734 3011 4.099113 ACATGATCATTGAGAGCGAGAAGA 59.901 41.667 5.16 0.0 34.70 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.