Multiple sequence alignment - TraesCS4A01G280300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G280300 chr4A 100.000 2438 0 0 1 2438 588743270 588745707 0 4503
1 TraesCS4A01G280300 chr4A 96.758 2437 76 3 1 2436 81354126 81351692 0 4060
2 TraesCS4A01G280300 chr7A 98.195 2438 41 3 1 2436 141722134 141724570 0 4255
3 TraesCS4A01G280300 chr7A 97.949 2438 44 3 1 2436 140847743 140850176 0 4220
4 TraesCS4A01G280300 chr7A 97.911 2441 44 7 1 2436 141422191 141424629 0 4218
5 TraesCS4A01G280300 chr7A 97.826 2438 51 2 1 2436 141138311 141140748 0 4207
6 TraesCS4A01G280300 chr7A 96.885 2440 70 6 1 2436 618748473 618746036 0 4080
7 TraesCS4A01G280300 chr7A 96.764 2441 72 6 1 2436 645171797 645174235 0 4063
8 TraesCS4A01G280300 chr6A 96.843 2439 70 7 1 2436 73419157 73421591 0 4071
9 TraesCS4A01G280300 chr3A 96.719 2438 75 5 1 2436 210616234 210618668 0 4054


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G280300 chr4A 588743270 588745707 2437 False 4503 4503 100.000 1 2438 1 chr4A.!!$F1 2437
1 TraesCS4A01G280300 chr4A 81351692 81354126 2434 True 4060 4060 96.758 1 2436 1 chr4A.!!$R1 2435
2 TraesCS4A01G280300 chr7A 141722134 141724570 2436 False 4255 4255 98.195 1 2436 1 chr7A.!!$F4 2435
3 TraesCS4A01G280300 chr7A 140847743 140850176 2433 False 4220 4220 97.949 1 2436 1 chr7A.!!$F1 2435
4 TraesCS4A01G280300 chr7A 141422191 141424629 2438 False 4218 4218 97.911 1 2436 1 chr7A.!!$F3 2435
5 TraesCS4A01G280300 chr7A 141138311 141140748 2437 False 4207 4207 97.826 1 2436 1 chr7A.!!$F2 2435
6 TraesCS4A01G280300 chr7A 618746036 618748473 2437 True 4080 4080 96.885 1 2436 1 chr7A.!!$R1 2435
7 TraesCS4A01G280300 chr7A 645171797 645174235 2438 False 4063 4063 96.764 1 2436 1 chr7A.!!$F5 2435
8 TraesCS4A01G280300 chr6A 73419157 73421591 2434 False 4071 4071 96.843 1 2436 1 chr6A.!!$F1 2435
9 TraesCS4A01G280300 chr3A 210616234 210618668 2434 False 4054 4054 96.719 1 2436 1 chr3A.!!$F1 2435

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
855 857 0.612732 CCCTGATTTGGCAGCTGGAA 60.613 55.0 17.12 0.0 34.56 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2368 2382 0.539438 TTGGCTTCGACCAATTGGCT 60.539 50.0 24.79 11.66 44.8 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
778 780 8.041323 GGAACTTTAGTGATAGTCTCATGGAAA 58.959 37.037 0.00 0.00 35.97 3.13
855 857 0.612732 CCCTGATTTGGCAGCTGGAA 60.613 55.000 17.12 0.00 34.56 3.53
887 889 1.691434 GTATTCCTCCAGCTCCCTCTG 59.309 57.143 0.00 0.00 0.00 3.35
933 935 4.486125 TTAACCCGTGTTTATCCCTACC 57.514 45.455 0.00 0.00 35.87 3.18
1534 1536 1.740025 GCTGAAAAAGAGGGACATCCG 59.260 52.381 0.00 0.00 41.52 4.18
1603 1605 3.311110 GGCTGACACGACCCCTCA 61.311 66.667 0.00 0.00 0.00 3.86
1628 1630 3.582647 TGAAGACCATGAAGGCTTCACTA 59.417 43.478 30.71 10.19 46.29 2.74
1738 1742 4.149598 CACCCCCTAGTTTGTAGCTTTTT 58.850 43.478 0.00 0.00 0.00 1.94
1813 1817 1.071542 TCGTTCTCAGCAATGGAACCA 59.928 47.619 0.00 0.00 36.85 3.67
1986 1992 2.079170 TCCTGGATTGTTTTGGCACA 57.921 45.000 0.00 0.00 0.00 4.57
2368 2382 2.673775 TTTGGAGGCTGAAATGTGGA 57.326 45.000 0.00 0.00 0.00 4.02
2436 2450 5.126061 ACAAATGATTCTGACATGTTAGCCC 59.874 40.000 12.62 5.08 0.00 5.19
2437 2451 4.785346 ATGATTCTGACATGTTAGCCCT 57.215 40.909 12.62 0.03 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 8.934023 ATTACAGACTAGAATAGAGAGGAAGG 57.066 38.462 0.00 0.00 42.77 3.46
778 780 3.611025 TTCCTCCAACTGGAACCATTT 57.389 42.857 0.00 0.00 44.91 2.32
887 889 9.628500 AAACCCCTCTAAAGTTGATAATATGAC 57.372 33.333 0.00 0.00 0.00 3.06
933 935 3.003480 GGGAACTCTCAATTTCCAGACG 58.997 50.000 2.94 0.00 42.85 4.18
1603 1605 0.990374 AGCCTTCATGGTCTTCAGCT 59.010 50.000 0.00 0.00 38.35 4.24
1738 1742 3.211045 AGCAGTTCGAAAGCAAAGGTAA 58.789 40.909 21.44 0.00 0.00 2.85
1986 1992 9.965824 CTTTTGTACACAATCACTAGGATTTTT 57.034 29.630 0.00 0.00 43.76 1.94
2339 2353 3.645434 TCAGCCTCCAAAAATATGGCAT 58.355 40.909 4.88 4.88 45.42 4.40
2368 2382 0.539438 TTGGCTTCGACCAATTGGCT 60.539 50.000 24.79 11.66 44.80 4.75
2395 2409 9.814899 AATCATTTGTTGACTAAATTGACAACA 57.185 25.926 0.00 0.00 45.31 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.