Multiple sequence alignment - TraesCS4A01G280000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G280000 chr4A 100.000 4073 0 0 1 4073 588583846 588587918 0.000000e+00 7522
1 TraesCS4A01G280000 chr4A 98.886 3948 33 3 126 4073 571358913 571362849 0.000000e+00 7036
2 TraesCS4A01G280000 chr4A 88.443 1445 158 6 720 2159 588633334 588634774 0.000000e+00 1735
3 TraesCS4A01G280000 chr4A 87.567 1303 112 20 2287 3547 588643404 588644698 0.000000e+00 1463
4 TraesCS4A01G280000 chr4A 93.308 523 29 4 3549 4066 588653812 588654333 0.000000e+00 767
5 TraesCS4A01G280000 chr4A 91.870 123 10 0 1 123 571358667 571358789 5.410000e-39 172
6 TraesCS4A01G280000 chr4D 97.461 2993 69 4 670 3659 13363067 13360079 0.000000e+00 5099
7 TraesCS4A01G280000 chr4D 89.108 2130 191 19 126 2245 13353201 13351103 0.000000e+00 2610
8 TraesCS4A01G280000 chr4D 90.426 846 48 15 3248 4066 13349990 13349151 0.000000e+00 1083
9 TraesCS4A01G280000 chr4D 93.862 668 29 10 126 785 13363659 13362996 0.000000e+00 996
10 TraesCS4A01G280000 chr7A 89.836 2017 183 14 234 2246 141893354 141895352 0.000000e+00 2569
11 TraesCS4A01G280000 chr7A 88.889 2016 183 20 234 2245 141302616 141304594 0.000000e+00 2444
12 TraesCS4A01G280000 chr7A 90.592 1807 154 11 234 2035 141642632 141644427 0.000000e+00 2381
13 TraesCS4A01G280000 chr7A 89.857 1824 131 21 2287 4066 140761003 140762816 0.000000e+00 2294
14 TraesCS4A01G280000 chr7A 89.748 1824 132 22 2287 4066 141049895 141051707 0.000000e+00 2281
15 TraesCS4A01G280000 chr7A 89.583 1824 136 21 2287 4066 141304686 141306499 0.000000e+00 2266
16 TraesCS4A01G280000 chr7A 90.000 1700 120 17 2411 4066 141644793 141646486 0.000000e+00 2152
17 TraesCS4A01G280000 chr7A 88.737 1536 160 9 717 2245 140759382 140760911 0.000000e+00 1866
18 TraesCS4A01G280000 chr7A 89.246 1432 105 18 2287 3678 141895443 141896865 0.000000e+00 1746
19 TraesCS4A01G280000 chr7A 93.827 486 22 6 234 717 141047581 141048060 0.000000e+00 725
20 TraesCS4A01G280000 chr7A 95.093 428 18 3 234 661 140758432 140758856 0.000000e+00 671
21 TraesCS4A01G280000 chr6A 89.121 1820 139 23 2292 4066 201639783 201641588 0.000000e+00 2209
22 TraesCS4A01G280000 chr6A 86.543 1189 149 8 1064 2245 201638502 201639686 0.000000e+00 1299
23 TraesCS4A01G280000 chr6A 90.636 566 24 11 1 566 201631148 201631684 0.000000e+00 725
24 TraesCS4A01G280000 chr4B 87.859 1532 174 9 721 2245 24068197 24066671 0.000000e+00 1788
25 TraesCS4A01G280000 chr4B 89.026 975 87 7 2290 3249 24066576 24065607 0.000000e+00 1190
26 TraesCS4A01G280000 chr4B 89.340 863 48 16 3248 4073 24065494 24064639 0.000000e+00 1044
27 TraesCS4A01G280000 chr4B 92.151 637 34 11 126 758 24068739 24068115 0.000000e+00 885
28 TraesCS4A01G280000 chr3B 86.160 1539 171 18 721 2245 454649276 454650786 0.000000e+00 1624
29 TraesCS4A01G280000 chr3B 88.731 985 84 9 2287 3249 454650878 454651857 0.000000e+00 1179
30 TraesCS4A01G280000 chr3B 82.583 666 62 28 126 758 454648721 454649365 4.630000e-149 538


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G280000 chr4A 588583846 588587918 4072 False 7522.000000 7522 100.000000 1 4073 1 chr4A.!!$F1 4072
1 TraesCS4A01G280000 chr4A 571358667 571362849 4182 False 3604.000000 7036 95.378000 1 4073 2 chr4A.!!$F5 4072
2 TraesCS4A01G280000 chr4A 588633334 588634774 1440 False 1735.000000 1735 88.443000 720 2159 1 chr4A.!!$F2 1439
3 TraesCS4A01G280000 chr4A 588643404 588644698 1294 False 1463.000000 1463 87.567000 2287 3547 1 chr4A.!!$F3 1260
4 TraesCS4A01G280000 chr4A 588653812 588654333 521 False 767.000000 767 93.308000 3549 4066 1 chr4A.!!$F4 517
5 TraesCS4A01G280000 chr4D 13360079 13363659 3580 True 3047.500000 5099 95.661500 126 3659 2 chr4D.!!$R2 3533
6 TraesCS4A01G280000 chr4D 13349151 13353201 4050 True 1846.500000 2610 89.767000 126 4066 2 chr4D.!!$R1 3940
7 TraesCS4A01G280000 chr7A 141302616 141306499 3883 False 2355.000000 2444 89.236000 234 4066 2 chr7A.!!$F3 3832
8 TraesCS4A01G280000 chr7A 141642632 141646486 3854 False 2266.500000 2381 90.296000 234 4066 2 chr7A.!!$F4 3832
9 TraesCS4A01G280000 chr7A 141893354 141896865 3511 False 2157.500000 2569 89.541000 234 3678 2 chr7A.!!$F5 3444
10 TraesCS4A01G280000 chr7A 140758432 140762816 4384 False 1610.333333 2294 91.229000 234 4066 3 chr7A.!!$F1 3832
11 TraesCS4A01G280000 chr7A 141047581 141051707 4126 False 1503.000000 2281 91.787500 234 4066 2 chr7A.!!$F2 3832
12 TraesCS4A01G280000 chr6A 201638502 201641588 3086 False 1754.000000 2209 87.832000 1064 4066 2 chr6A.!!$F2 3002
13 TraesCS4A01G280000 chr6A 201631148 201631684 536 False 725.000000 725 90.636000 1 566 1 chr6A.!!$F1 565
14 TraesCS4A01G280000 chr4B 24064639 24068739 4100 True 1226.750000 1788 89.594000 126 4073 4 chr4B.!!$R1 3947
15 TraesCS4A01G280000 chr3B 454648721 454651857 3136 False 1113.666667 1624 85.824667 126 3249 3 chr3B.!!$F1 3123

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
123 124 1.201629 CGGTTTGTCGTCGAATCGAAC 60.202 52.381 7.01 3.47 42.31 3.95 F
143 266 2.226065 ACTCCTACACCCCATAAACCCT 60.226 50.000 0.00 0.00 0.00 4.34 F
1237 2110 4.794334 AGATCCTCGTATACTTGGTGAGT 58.206 43.478 0.56 0.00 42.55 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1237 2110 0.409876 AGCAGTACAGACCCTCCAGA 59.590 55.000 0.00 0.0 0.00 3.86 R
2145 3031 2.253758 GCAAGGCGCACAAGACTCA 61.254 57.895 10.83 0.0 41.79 3.41 R
3124 4079 1.068748 GTGCCTGCACACTTTCAGATG 60.069 52.381 16.95 0.0 45.53 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.823758 GGGGTGAGCATAGGGGAGC 61.824 68.421 0.00 0.00 0.00 4.70
123 124 1.201629 CGGTTTGTCGTCGAATCGAAC 60.202 52.381 7.01 3.47 42.31 3.95
143 266 2.226065 ACTCCTACACCCCATAAACCCT 60.226 50.000 0.00 0.00 0.00 4.34
1237 2110 4.794334 AGATCCTCGTATACTTGGTGAGT 58.206 43.478 0.56 0.00 42.55 3.41
2145 3031 6.872920 TGTGAATGGTAAAAGTTTGAAGCTT 58.127 32.000 0.00 0.00 0.00 3.74
2152 3038 6.377146 TGGTAAAAGTTTGAAGCTTGAGTCTT 59.623 34.615 2.10 1.07 0.00 3.01
2604 3543 1.059584 TCTCCACTGCCCTCACCAAA 61.060 55.000 0.00 0.00 0.00 3.28
2988 3928 2.840038 TGGCTCCTCTGTTACATGTGAT 59.160 45.455 9.11 0.00 0.00 3.06
3124 4079 3.864686 CTACACGGCGCACCATGC 61.865 66.667 10.83 0.00 40.69 4.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 4.904251 TCCCTCTCCTAATTTCTCTCCATG 59.096 45.833 0.00 0.00 0.00 3.66
123 124 2.488836 AGGGTTTATGGGGTGTAGGAG 58.511 52.381 0.00 0.00 0.00 3.69
1062 1935 1.215673 TCCAACTGGCCCACTAAACAA 59.784 47.619 0.00 0.00 34.44 2.83
1237 2110 0.409876 AGCAGTACAGACCCTCCAGA 59.590 55.000 0.00 0.00 0.00 3.86
2145 3031 2.253758 GCAAGGCGCACAAGACTCA 61.254 57.895 10.83 0.00 41.79 3.41
2152 3038 4.631247 AGCAGAGCAAGGCGCACA 62.631 61.111 10.83 0.00 46.13 4.57
2604 3543 2.363147 GGGACGGTGGAGAGCTCT 60.363 66.667 18.28 18.28 0.00 4.09
2988 3928 7.867921 ACCAAATTACAGACCTATATCAACCA 58.132 34.615 0.00 0.00 0.00 3.67
3124 4079 1.068748 GTGCCTGCACACTTTCAGATG 60.069 52.381 16.95 0.00 45.53 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.