Multiple sequence alignment - TraesCS4A01G279700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G279700 chr4A 100.000 2970 0 0 1 2970 586856087 586859056 0.000000e+00 5485
1 TraesCS4A01G279700 chr4A 99.260 2971 20 2 1 2970 586921782 586918813 0.000000e+00 5363
2 TraesCS4A01G279700 chr4A 98.690 1909 23 2 1064 2970 574158660 574156752 0.000000e+00 3386
3 TraesCS4A01G279700 chr4A 98.222 1912 32 2 1061 2970 457236433 457238344 0.000000e+00 3341
4 TraesCS4A01G279700 chr6D 91.912 1768 94 22 1239 2970 458140650 458142404 0.000000e+00 2427
5 TraesCS4A01G279700 chr6D 95.056 1072 43 8 1 1067 446724399 446723333 0.000000e+00 1677
6 TraesCS4A01G279700 chr6D 91.875 160 12 1 1061 1219 458262060 458262219 3.850000e-54 222
7 TraesCS4A01G279700 chr4D 86.792 1961 154 41 1067 2970 13929339 13931251 0.000000e+00 2089
8 TraesCS4A01G279700 chr4D 86.741 1961 155 41 1067 2970 13745113 13747025 0.000000e+00 2084
9 TraesCS4A01G279700 chr4D 86.690 1961 156 41 1067 2970 13839864 13841776 0.000000e+00 2078
10 TraesCS4A01G279700 chr4B 86.786 1960 156 43 1067 2970 24539466 24541378 0.000000e+00 2089
11 TraesCS4A01G279700 chr4B 86.537 1961 159 41 1067 2970 24399241 24401153 0.000000e+00 2061
12 TraesCS4A01G279700 chr3B 86.463 1965 164 44 1064 2970 454190558 454188638 0.000000e+00 2061
13 TraesCS4A01G279700 chr3B 85.100 953 72 28 2046 2970 453994707 453993797 0.000000e+00 909
14 TraesCS4A01G279700 chr1B 97.092 1066 31 0 1 1066 560246064 560244999 0.000000e+00 1797
15 TraesCS4A01G279700 chr2D 96.248 1066 39 1 1 1066 629997843 629996779 0.000000e+00 1746
16 TraesCS4A01G279700 chr2D 95.966 1066 43 0 1 1066 600426765 600425700 0.000000e+00 1731
17 TraesCS4A01G279700 chr2D 95.257 991 47 0 1 991 15957070 15956080 0.000000e+00 1570
18 TraesCS4A01G279700 chr7B 96.157 1067 38 2 1 1066 66975077 66976141 0.000000e+00 1740
19 TraesCS4A01G279700 chrUn 95.789 1045 43 1 1 1045 347184678 347185721 0.000000e+00 1685
20 TraesCS4A01G279700 chrUn 86.223 1488 112 38 1528 2970 379573557 379574996 0.000000e+00 1526
21 TraesCS4A01G279700 chrUn 91.250 160 13 1 1061 1219 362323176 362323335 1.790000e-52 217
22 TraesCS4A01G279700 chr5D 94.967 1073 42 9 1 1066 398486577 398485510 0.000000e+00 1672
23 TraesCS4A01G279700 chr2A 93.750 112 6 1 956 1066 745778263 745778374 1.830000e-37 167
24 TraesCS4A01G279700 chr3A 91.667 84 6 1 984 1066 745421718 745421635 6.730000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G279700 chr4A 586856087 586859056 2969 False 5485 5485 100.000 1 2970 1 chr4A.!!$F2 2969
1 TraesCS4A01G279700 chr4A 586918813 586921782 2969 True 5363 5363 99.260 1 2970 1 chr4A.!!$R2 2969
2 TraesCS4A01G279700 chr4A 574156752 574158660 1908 True 3386 3386 98.690 1064 2970 1 chr4A.!!$R1 1906
3 TraesCS4A01G279700 chr4A 457236433 457238344 1911 False 3341 3341 98.222 1061 2970 1 chr4A.!!$F1 1909
4 TraesCS4A01G279700 chr6D 458140650 458142404 1754 False 2427 2427 91.912 1239 2970 1 chr6D.!!$F1 1731
5 TraesCS4A01G279700 chr6D 446723333 446724399 1066 True 1677 1677 95.056 1 1067 1 chr6D.!!$R1 1066
6 TraesCS4A01G279700 chr4D 13929339 13931251 1912 False 2089 2089 86.792 1067 2970 1 chr4D.!!$F3 1903
7 TraesCS4A01G279700 chr4D 13745113 13747025 1912 False 2084 2084 86.741 1067 2970 1 chr4D.!!$F1 1903
8 TraesCS4A01G279700 chr4D 13839864 13841776 1912 False 2078 2078 86.690 1067 2970 1 chr4D.!!$F2 1903
9 TraesCS4A01G279700 chr4B 24539466 24541378 1912 False 2089 2089 86.786 1067 2970 1 chr4B.!!$F2 1903
10 TraesCS4A01G279700 chr4B 24399241 24401153 1912 False 2061 2061 86.537 1067 2970 1 chr4B.!!$F1 1903
11 TraesCS4A01G279700 chr3B 454188638 454190558 1920 True 2061 2061 86.463 1064 2970 1 chr3B.!!$R2 1906
12 TraesCS4A01G279700 chr3B 453993797 453994707 910 True 909 909 85.100 2046 2970 1 chr3B.!!$R1 924
13 TraesCS4A01G279700 chr1B 560244999 560246064 1065 True 1797 1797 97.092 1 1066 1 chr1B.!!$R1 1065
14 TraesCS4A01G279700 chr2D 629996779 629997843 1064 True 1746 1746 96.248 1 1066 1 chr2D.!!$R3 1065
15 TraesCS4A01G279700 chr2D 600425700 600426765 1065 True 1731 1731 95.966 1 1066 1 chr2D.!!$R2 1065
16 TraesCS4A01G279700 chr2D 15956080 15957070 990 True 1570 1570 95.257 1 991 1 chr2D.!!$R1 990
17 TraesCS4A01G279700 chr7B 66975077 66976141 1064 False 1740 1740 96.157 1 1066 1 chr7B.!!$F1 1065
18 TraesCS4A01G279700 chrUn 347184678 347185721 1043 False 1685 1685 95.789 1 1045 1 chrUn.!!$F1 1044
19 TraesCS4A01G279700 chrUn 379573557 379574996 1439 False 1526 1526 86.223 1528 2970 1 chrUn.!!$F3 1442
20 TraesCS4A01G279700 chr5D 398485510 398486577 1067 True 1672 1672 94.967 1 1066 1 chr5D.!!$R1 1065

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
470 475 1.040646 CTCGGCTGGCCATTAGTCTA 58.959 55.0 5.51 0.0 35.37 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2907 3008 1.616456 GGACCTGAGAAGGTAGTCGGT 60.616 57.143 0.0 0.0 43.24 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 2.135139 GCTTAATCATGTGGCGATCGA 58.865 47.619 21.57 0.0 0.00 3.59
160 161 5.420104 GTCCAAATTCCCTCTTGATTGATGT 59.580 40.000 0.00 0.0 0.00 3.06
470 475 1.040646 CTCGGCTGGCCATTAGTCTA 58.959 55.000 5.51 0.0 35.37 2.59
772 777 3.725634 ACTTACCCTGATTGGAGTAGCT 58.274 45.455 0.00 0.0 38.35 3.32
1819 1871 1.134310 TGATCATGTGCAGCTACCAGG 60.134 52.381 0.00 0.0 0.00 4.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 3.485947 TCGCCACATGATTAAGCAAAC 57.514 42.857 0.00 0.00 0.00 2.93
46 47 2.611518 GCAGCGTCAACTCTTAGATGT 58.388 47.619 0.00 0.00 0.00 3.06
160 161 4.574892 TGTATGGCTCGAGTTCAATTCAA 58.425 39.130 15.13 0.00 0.00 2.69
470 475 4.262164 CCTTACAGCAATTGCCAAGAACTT 60.262 41.667 26.45 2.53 43.38 2.66
772 777 2.122413 ACCACCTCTCTGGCCACA 60.122 61.111 0.00 0.00 40.22 4.17
847 852 1.715862 CGTCTCTTCCATCTCGCCGA 61.716 60.000 0.00 0.00 0.00 5.54
2907 3008 1.616456 GGACCTGAGAAGGTAGTCGGT 60.616 57.143 0.00 0.00 43.24 4.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.