Multiple sequence alignment - TraesCS4A01G279300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G279300 chr4A 100.000 2672 0 0 1 2672 586707732 586710403 0.000000e+00 4935.0
1 TraesCS4A01G279300 chr4A 98.429 2673 25 5 1 2672 456458675 456461331 0.000000e+00 4687.0
2 TraesCS4A01G279300 chr4A 95.745 47 2 0 222 268 487914977 487915023 2.850000e-10 76.8
3 TraesCS4A01G279300 chr4D 86.891 2174 189 46 277 2402 14848563 14846438 0.000000e+00 2348.0
4 TraesCS4A01G279300 chr4D 92.144 1031 61 8 1389 2402 14473614 14474641 0.000000e+00 1437.0
5 TraesCS4A01G279300 chr4D 83.898 1565 189 31 853 2379 14843665 14842126 0.000000e+00 1435.0
6 TraesCS4A01G279300 chr4D 82.109 1688 217 60 534 2170 14914156 14915809 0.000000e+00 1365.0
7 TraesCS4A01G279300 chr4D 83.955 1421 178 34 865 2251 14862672 14864076 0.000000e+00 1315.0
8 TraesCS4A01G279300 chr4D 93.727 271 17 0 2402 2672 14474770 14475040 8.910000e-110 407.0
9 TraesCS4A01G279300 chr4D 88.333 180 8 9 637 803 14514034 14514213 1.250000e-48 204.0
10 TraesCS4A01G279300 chr4D 86.842 190 11 4 637 812 14843858 14843669 1.620000e-47 200.0
11 TraesCS4A01G279300 chr3B 84.911 1796 213 30 481 2241 452724777 452726549 0.000000e+00 1762.0
12 TraesCS4A01G279300 chr3B 86.965 1473 141 29 360 1793 452720896 452722356 0.000000e+00 1609.0
13 TraesCS4A01G279300 chr3B 87.705 122 6 6 277 393 452720784 452720901 1.670000e-27 134.0
14 TraesCS4A01G279300 chr4B 84.720 1695 199 27 367 2021 24691155 24689481 0.000000e+00 1640.0
15 TraesCS4A01G279300 chr4B 89.582 1171 115 6 898 2064 24696818 24695651 0.000000e+00 1480.0
16 TraesCS4A01G279300 chr4B 81.910 1675 222 61 615 2245 24759056 24760693 0.000000e+00 1339.0
17 TraesCS4A01G279300 chr4B 90.536 317 22 4 2090 2400 24695577 24695263 1.910000e-111 412.0
18 TraesCS4A01G279300 chr4B 90.476 168 12 1 277 440 24703705 24703538 4.480000e-53 219.0
19 TraesCS4A01G279300 chr1D 83.240 179 26 4 114 290 28185801 28185625 7.650000e-36 161.0
20 TraesCS4A01G279300 chr5D 83.333 168 21 6 106 271 360977664 360977826 5.960000e-32 148.0
21 TraesCS4A01G279300 chr6A 80.247 162 31 1 103 264 46608148 46608308 1.300000e-23 121.0
22 TraesCS4A01G279300 chr3A 91.071 56 5 0 216 271 36944416 36944471 2.850000e-10 76.8
23 TraesCS4A01G279300 chr3A 92.683 41 3 0 212 252 724933579 724933619 2.870000e-05 60.2
24 TraesCS4A01G279300 chr3D 92.308 52 4 0 218 269 578274308 578274359 1.030000e-09 75.0
25 TraesCS4A01G279300 chr7B 94.595 37 2 0 212 248 676300251 676300215 1.030000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G279300 chr4A 586707732 586710403 2671 False 4935.000000 4935 100.0000 1 2672 1 chr4A.!!$F3 2671
1 TraesCS4A01G279300 chr4A 456458675 456461331 2656 False 4687.000000 4687 98.4290 1 2672 1 chr4A.!!$F1 2671
2 TraesCS4A01G279300 chr4D 14914156 14915809 1653 False 1365.000000 1365 82.1090 534 2170 1 chr4D.!!$F3 1636
3 TraesCS4A01G279300 chr4D 14842126 14848563 6437 True 1327.666667 2348 85.8770 277 2402 3 chr4D.!!$R1 2125
4 TraesCS4A01G279300 chr4D 14862672 14864076 1404 False 1315.000000 1315 83.9550 865 2251 1 chr4D.!!$F2 1386
5 TraesCS4A01G279300 chr4D 14473614 14475040 1426 False 922.000000 1437 92.9355 1389 2672 2 chr4D.!!$F4 1283
6 TraesCS4A01G279300 chr3B 452720784 452726549 5765 False 1168.333333 1762 86.5270 277 2241 3 chr3B.!!$F1 1964
7 TraesCS4A01G279300 chr4B 24689481 24691155 1674 True 1640.000000 1640 84.7200 367 2021 1 chr4B.!!$R1 1654
8 TraesCS4A01G279300 chr4B 24759056 24760693 1637 False 1339.000000 1339 81.9100 615 2245 1 chr4B.!!$F1 1630
9 TraesCS4A01G279300 chr4B 24695263 24696818 1555 True 946.000000 1480 90.0590 898 2400 2 chr4B.!!$R3 1502

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
793 888 0.322008 CTCTGCTTCCAGTGTTCCCC 60.322 60.0 0.0 0.0 40.09 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2527 7959 0.106708 GCTGGATCACCGCCATAAGA 59.893 55.0 0.0 0.0 39.42 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
224 225 1.600663 CCACCATATCTGACGTCTCGC 60.601 57.143 17.92 0.00 0.00 5.03
522 591 5.909621 AGTTGTGCTTATCCTTCTACGTA 57.090 39.130 0.00 0.00 0.00 3.57
793 888 0.322008 CTCTGCTTCCAGTGTTCCCC 60.322 60.000 0.00 0.00 40.09 4.81
1035 1177 2.238144 ACTCATAGCTGGCATGTTCACT 59.762 45.455 0.00 0.00 0.00 3.41
1096 1238 2.904434 GACCCTCTCCAGGACTTTTGTA 59.096 50.000 0.00 0.00 43.65 2.41
1332 1474 1.302913 CACCAACCCGCCACACATA 60.303 57.895 0.00 0.00 0.00 2.29
1428 1570 2.180276 GGGAACAAGCTCTACTCCAGA 58.820 52.381 0.00 0.00 0.00 3.86
1449 1591 4.724602 GTGCGCGCTGGAGAGACA 62.725 66.667 33.29 5.03 0.00 3.41
1954 7179 7.375053 TGTTGCCCTTTTATAAGTCAAACATC 58.625 34.615 0.00 0.00 0.00 3.06
2527 7959 6.596309 TGTCGATCTATTATCAAGGATGCT 57.404 37.500 0.00 0.00 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
224 225 2.018542 TTAAAAGATCCGCCACCTCG 57.981 50.000 0.00 0.0 0.00 4.63
522 591 3.006752 TCGAAATTCAGGCAAAAATGGCT 59.993 39.130 0.00 0.0 46.05 4.75
1035 1177 1.402896 CCGGAGCAAGGAGGAGCATA 61.403 60.000 0.00 0.0 0.00 3.14
1449 1591 2.505982 CCGCGTGGGATGAGGAAT 59.494 61.111 7.26 0.0 38.47 3.01
1954 7179 1.336517 TGGCGACGTAAACTTGAGAGG 60.337 52.381 0.00 0.0 0.00 3.69
2300 7602 1.968704 TGGTTTGTTGTGTATCGCCA 58.031 45.000 0.00 0.0 0.00 5.69
2527 7959 0.106708 GCTGGATCACCGCCATAAGA 59.893 55.000 0.00 0.0 39.42 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.