Multiple sequence alignment - TraesCS4A01G278200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G278200 chr4A 100.000 2630 0 0 1 2630 585678342 585680971 0.000000e+00 4857.0
1 TraesCS4A01G278200 chr4A 72.944 377 84 16 515 882 743416558 743416925 5.950000e-22 115.0
2 TraesCS4A01G278200 chr7D 98.281 1687 27 2 1 1686 7281882 7280197 0.000000e+00 2953.0
3 TraesCS4A01G278200 chr5D 98.213 1679 30 0 1 1679 376713845 376715523 0.000000e+00 2935.0
4 TraesCS4A01G278200 chr5D 81.111 90 14 3 2380 2467 70484876 70484788 4.700000e-08 69.4
5 TraesCS4A01G278200 chr3A 97.853 1677 36 0 1 1677 637618283 637616607 0.000000e+00 2898.0
6 TraesCS4A01G278200 chr3A 73.473 524 120 18 389 903 465811280 465811793 2.080000e-41 180.0
7 TraesCS4A01G278200 chr3A 87.037 54 5 2 2243 2294 568528517 568528464 2.830000e-05 60.2
8 TraesCS4A01G278200 chr6D 97.806 1504 33 0 1 1504 327626184 327627687 0.000000e+00 2595.0
9 TraesCS4A01G278200 chr6D 97.814 183 4 0 1494 1676 327630259 327630441 1.520000e-82 316.0
10 TraesCS4A01G278200 chr1A 88.386 1679 178 6 1 1678 584317134 584315472 0.000000e+00 2004.0
11 TraesCS4A01G278200 chr1A 90.196 51 5 0 2426 2476 584776600 584776550 1.690000e-07 67.6
12 TraesCS4A01G278200 chr2A 97.699 956 13 8 1678 2630 195816572 195817521 0.000000e+00 1635.0
13 TraesCS4A01G278200 chr2A 82.022 89 13 3 2385 2472 144608169 144608255 3.630000e-09 73.1
14 TraesCS4A01G278200 chr2A 93.182 44 2 1 2434 2477 631637328 631637370 2.190000e-06 63.9
15 TraesCS4A01G278200 chr4B 89.050 621 46 12 1678 2294 25396534 25395932 0.000000e+00 750.0
16 TraesCS4A01G278200 chr4B 83.333 78 9 3 2398 2473 480650836 480650911 4.700000e-08 69.4
17 TraesCS4A01G278200 chr7A 98.031 254 5 0 1425 1678 92857892 92858145 2.400000e-120 442.0
18 TraesCS4A01G278200 chr2B 72.266 512 124 18 389 891 4474422 4474924 2.730000e-30 143.0
19 TraesCS4A01G278200 chr2B 85.075 67 9 1 2407 2472 13906422 13906356 1.690000e-07 67.6
20 TraesCS4A01G278200 chr2D 75.203 246 40 17 2239 2478 695663 695433 2.150000e-16 97.1
21 TraesCS4A01G278200 chrUn 75.000 236 37 18 2239 2467 414064721 414064501 3.610000e-14 89.8
22 TraesCS4A01G278200 chr3B 96.875 32 1 0 2185 2216 620659076 620659045 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G278200 chr4A 585678342 585680971 2629 False 4857.0 4857 100.000 1 2630 1 chr4A.!!$F1 2629
1 TraesCS4A01G278200 chr7D 7280197 7281882 1685 True 2953.0 2953 98.281 1 1686 1 chr7D.!!$R1 1685
2 TraesCS4A01G278200 chr5D 376713845 376715523 1678 False 2935.0 2935 98.213 1 1679 1 chr5D.!!$F1 1678
3 TraesCS4A01G278200 chr3A 637616607 637618283 1676 True 2898.0 2898 97.853 1 1677 1 chr3A.!!$R2 1676
4 TraesCS4A01G278200 chr6D 327626184 327630441 4257 False 1455.5 2595 97.810 1 1676 2 chr6D.!!$F1 1675
5 TraesCS4A01G278200 chr1A 584315472 584317134 1662 True 2004.0 2004 88.386 1 1678 1 chr1A.!!$R1 1677
6 TraesCS4A01G278200 chr2A 195816572 195817521 949 False 1635.0 1635 97.699 1678 2630 1 chr2A.!!$F2 952
7 TraesCS4A01G278200 chr4B 25395932 25396534 602 True 750.0 750 89.050 1678 2294 1 chr4B.!!$R1 616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
508 509 2.703798 CCGCAGCCAAGGGTCATTG 61.704 63.158 0.0 0.0 0.0 2.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1695 4279 0.036388 CCAGCCCATTACTGTGTCGT 60.036 55.0 0.0 0.0 33.09 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 123 5.385198 TCCTAAATCTGCTTTTTGGACAGT 58.615 37.500 6.49 0.00 36.17 3.55
368 369 5.683681 TGATACTGCTGCAGAAATAATCCA 58.316 37.500 34.28 17.09 35.18 3.41
508 509 2.703798 CCGCAGCCAAGGGTCATTG 61.704 63.158 0.00 0.00 0.00 2.82
686 687 2.810274 GCAGTGCTGAAGAAGATGAACA 59.190 45.455 8.18 0.00 0.00 3.18
836 837 4.702131 AGACCATCCTCATGCAAGTTTAAC 59.298 41.667 0.00 0.00 0.00 2.01
892 893 8.572185 GGAAAGTTAGAAATGAGAAGCTTTTCT 58.428 33.333 17.07 15.10 46.55 2.52
1103 1104 1.134007 TGCAGCATGGAATCTACAGGG 60.134 52.381 0.00 0.00 35.86 4.45
1115 1116 0.323629 CTACAGGGGAGCCAAAACGA 59.676 55.000 0.00 0.00 0.00 3.85
1176 1177 7.633193 TCAACTTAAGCAAGGTTACTCAAAA 57.367 32.000 1.29 0.00 35.97 2.44
1603 4186 5.539955 ACTCAAATGCAGGGATTTGTACTTT 59.460 36.000 20.69 4.84 41.93 2.66
2149 4741 6.648879 ACACATGCCTACTTTTGTACATTT 57.351 33.333 0.00 0.00 0.00 2.32
2329 4921 7.277760 TGACTAACATTTTCGTAGACATGATGG 59.722 37.037 0.00 0.00 34.32 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 123 8.758829 TGAGCATAGGTCTAACTTTGAGAATAA 58.241 33.333 0.00 0.00 0.00 1.40
368 369 1.953686 CGGATTGGATAATGGGCGTTT 59.046 47.619 0.00 0.00 0.00 3.60
508 509 3.942130 AAGGGCTTTTGTATTGTCTGC 57.058 42.857 0.00 0.00 0.00 4.26
892 893 2.308866 CAGGGGAGCCTTCTTTCCTTTA 59.691 50.000 0.00 0.00 33.85 1.85
1103 1104 3.005367 TCCTTCATTTTCGTTTTGGCTCC 59.995 43.478 0.00 0.00 0.00 4.70
1115 1116 2.298163 CCTGCTTGTGCTCCTTCATTTT 59.702 45.455 0.00 0.00 40.48 1.82
1176 1177 3.575256 TGGCTGAAATTGATGCTTGAAGT 59.425 39.130 0.00 0.00 0.00 3.01
1238 1239 0.476338 TGCTGCCAACTTTAGACCCA 59.524 50.000 0.00 0.00 0.00 4.51
1695 4279 0.036388 CCAGCCCATTACTGTGTCGT 60.036 55.000 0.00 0.00 33.09 4.34
1919 4507 7.818493 AAAAAGAGAAAACAGAAGAAAGCAC 57.182 32.000 0.00 0.00 0.00 4.40
2117 4709 4.853924 AGTAGGCATGTGTTGGAAAAAG 57.146 40.909 0.00 0.00 0.00 2.27
2583 5175 4.371855 AGATGACATCGTACGTGTTCAT 57.628 40.909 20.41 20.41 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.