Multiple sequence alignment - TraesCS4A01G270300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G270300 chr4A 100.000 2408 0 0 1 2408 581495297 581492890 0.000000e+00 4447
1 TraesCS4A01G270300 chr6D 95.272 2411 105 8 1 2408 420230699 420228295 0.000000e+00 3812
2 TraesCS4A01G270300 chr6D 94.207 397 22 1 1939 2334 28310772 28310376 2.650000e-169 604
3 TraesCS4A01G270300 chr5A 93.872 2415 116 14 1 2408 611980616 611978227 0.000000e+00 3611
4 TraesCS4A01G270300 chr5A 98.066 1241 17 2 1 1234 124618482 124619722 0.000000e+00 2152
5 TraesCS4A01G270300 chr5A 98.086 888 15 2 1523 2408 124621660 124622547 0.000000e+00 1544
6 TraesCS4A01G270300 chr5D 93.705 2351 122 18 1 2334 441571765 441569424 0.000000e+00 3498
7 TraesCS4A01G270300 chr5D 93.131 2344 128 25 10 2332 490439530 490437199 0.000000e+00 3406
8 TraesCS4A01G270300 chr7A 92.702 1932 105 19 416 2331 47296922 47295011 0.000000e+00 2754
9 TraesCS4A01G270300 chr7A 86.904 1237 122 26 199 1420 213100428 213101639 0.000000e+00 1351
10 TraesCS4A01G270300 chr7D 92.436 1732 84 18 2 1719 44719335 44717637 0.000000e+00 2429
11 TraesCS4A01G270300 chr7D 91.952 584 40 5 1754 2334 44717535 44716956 0.000000e+00 811
12 TraesCS4A01G270300 chr5B 93.789 1272 64 9 1 1263 604870284 604871549 0.000000e+00 1897
13 TraesCS4A01G270300 chr1B 86.002 1243 131 28 199 1423 299551458 299550241 0.000000e+00 1291
14 TraesCS4A01G270300 chr1B 86.116 533 61 12 1418 1940 299550066 299549537 1.620000e-156 562
15 TraesCS4A01G270300 chr1B 86.466 266 24 9 2152 2408 68137235 68136973 5.070000e-72 281
16 TraesCS4A01G270300 chr7B 87.861 519 55 7 1425 1937 433801125 433801641 9.520000e-169 603
17 TraesCS4A01G270300 chr6A 94.057 387 22 1 1939 2324 29577274 29577660 9.590000e-164 586
18 TraesCS4A01G270300 chr3A 86.174 528 63 8 1418 1937 282155377 282155902 1.620000e-156 562
19 TraesCS4A01G270300 chr2D 87.121 264 23 8 2152 2408 30412134 30412393 3.030000e-74 289


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G270300 chr4A 581492890 581495297 2407 True 4447.0 4447 100.000 1 2408 1 chr4A.!!$R1 2407
1 TraesCS4A01G270300 chr6D 420228295 420230699 2404 True 3812.0 3812 95.272 1 2408 1 chr6D.!!$R2 2407
2 TraesCS4A01G270300 chr5A 611978227 611980616 2389 True 3611.0 3611 93.872 1 2408 1 chr5A.!!$R1 2407
3 TraesCS4A01G270300 chr5A 124618482 124622547 4065 False 1848.0 2152 98.076 1 2408 2 chr5A.!!$F1 2407
4 TraesCS4A01G270300 chr5D 441569424 441571765 2341 True 3498.0 3498 93.705 1 2334 1 chr5D.!!$R1 2333
5 TraesCS4A01G270300 chr5D 490437199 490439530 2331 True 3406.0 3406 93.131 10 2332 1 chr5D.!!$R2 2322
6 TraesCS4A01G270300 chr7A 47295011 47296922 1911 True 2754.0 2754 92.702 416 2331 1 chr7A.!!$R1 1915
7 TraesCS4A01G270300 chr7A 213100428 213101639 1211 False 1351.0 1351 86.904 199 1420 1 chr7A.!!$F1 1221
8 TraesCS4A01G270300 chr7D 44716956 44719335 2379 True 1620.0 2429 92.194 2 2334 2 chr7D.!!$R1 2332
9 TraesCS4A01G270300 chr5B 604870284 604871549 1265 False 1897.0 1897 93.789 1 1263 1 chr5B.!!$F1 1262
10 TraesCS4A01G270300 chr1B 299549537 299551458 1921 True 926.5 1291 86.059 199 1940 2 chr1B.!!$R2 1741
11 TraesCS4A01G270300 chr7B 433801125 433801641 516 False 603.0 603 87.861 1425 1937 1 chr7B.!!$F1 512
12 TraesCS4A01G270300 chr3A 282155377 282155902 525 False 562.0 562 86.174 1418 1937 1 chr3A.!!$F1 519

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
854 885 0.449388 CATTTGAGACCCGCTTCAGC 59.551 55.0 0.0 0.0 37.78 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2011 4000 1.269257 GCCAGAAGAACAAACCTGCAC 60.269 52.381 0.0 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
854 885 0.449388 CATTTGAGACCCGCTTCAGC 59.551 55.000 0.00 0.0 37.78 4.26
1308 2213 4.019792 TGACATGGAAGCACTGTACAAT 57.980 40.909 0.00 0.0 0.00 2.71
1861 3848 6.093357 CAGCTGAAGTTCCTCTATTTTCTTCC 59.907 42.308 8.42 0.0 32.93 3.46
2011 4000 6.183360 CCAGTAATCTTGCTGTCTTTTATGGG 60.183 42.308 7.16 0.0 38.95 4.00
2254 4248 4.441913 CCATTGGGGTTGCTCATGAATTAC 60.442 45.833 0.00 0.0 0.00 1.89
2262 4256 6.532657 GGGTTGCTCATGAATTACAGAATTTG 59.467 38.462 0.00 0.0 35.33 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 137 9.318041 CAAGTTGTATATTCTTTGACACTTTCG 57.682 33.333 0.00 0.00 0.00 3.46
631 650 4.603989 TCCATGTTTACCAACTACGTCA 57.396 40.909 0.00 0.00 33.58 4.35
634 654 4.379082 GGCTTTCCATGTTTACCAACTACG 60.379 45.833 0.00 0.00 33.58 3.51
854 885 4.308526 CCTGCAGTAGCCAACAGG 57.691 61.111 13.81 0.00 43.45 4.00
1267 2172 0.179234 TCGGCCGCAATATTCTTCCA 59.821 50.000 23.51 0.00 0.00 3.53
1308 2213 3.056678 CACAAATGGCAGCATGAACCTTA 60.057 43.478 0.00 0.00 39.69 2.69
1725 3627 2.126965 CGTCCGTCGTGTCTGACC 60.127 66.667 5.17 0.00 35.40 4.02
1861 3848 4.142138 ACAAATCGTCAGGGCTCTTAGTAG 60.142 45.833 0.00 0.00 0.00 2.57
2011 4000 1.269257 GCCAGAAGAACAAACCTGCAC 60.269 52.381 0.00 0.00 0.00 4.57
2254 4248 6.599244 TCATCTTACTGTAAGCCCAAATTCTG 59.401 38.462 20.16 8.00 37.60 3.02
2262 4256 4.876679 GGAAGTTCATCTTACTGTAAGCCC 59.123 45.833 20.16 7.78 34.81 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.