Multiple sequence alignment - TraesCS4A01G254400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G254400 chr4A 100.000 2445 0 0 1 2445 566590644 566588200 0.000000e+00 4516
1 TraesCS4A01G254400 chr4A 99.253 2410 18 0 1 2410 566611346 566608937 0.000000e+00 4351
2 TraesCS4A01G254400 chr4A 94.828 638 33 0 1 638 101106754 101106117 0.000000e+00 996
3 TraesCS4A01G254400 chr4A 94.803 635 33 0 1 635 604131221 604130587 0.000000e+00 990
4 TraesCS4A01G254400 chr4A 92.511 681 49 1 1 679 476644615 476645295 0.000000e+00 974
5 TraesCS4A01G254400 chr3A 95.674 1826 77 2 621 2445 128659595 128657771 0.000000e+00 2933
6 TraesCS4A01G254400 chr3A 95.095 632 31 0 1 632 87633058 87633689 0.000000e+00 996
7 TraesCS4A01G254400 chr2A 95.455 1826 65 3 621 2445 276858469 276860277 0.000000e+00 2896
8 TraesCS4A01G254400 chr2A 88.535 157 17 1 2278 2434 131912320 131912165 3.210000e-44 189
9 TraesCS4A01G254400 chr5A 94.633 1826 72 11 621 2445 136567991 136569791 0.000000e+00 2806
10 TraesCS4A01G254400 chr5A 95.367 626 29 0 1 626 569902904 569903529 0.000000e+00 996
11 TraesCS4A01G254400 chr3B 92.143 1820 137 5 632 2445 367032886 367031067 0.000000e+00 2564
12 TraesCS4A01G254400 chr3B 91.914 1818 140 7 632 2445 379653319 379655133 0.000000e+00 2536
13 TraesCS4A01G254400 chr6B 92.278 1800 131 8 650 2445 129700708 129702503 0.000000e+00 2547
14 TraesCS4A01G254400 chr5B 90.790 1835 134 12 622 2445 328273371 328275181 0.000000e+00 2420
15 TraesCS4A01G254400 chr5B 82.072 753 95 27 1 734 159192715 159191984 7.480000e-170 606
16 TraesCS4A01G254400 chr6D 91.235 1563 106 8 888 2445 17043132 17041596 0.000000e+00 2098
17 TraesCS4A01G254400 chr1A 95.118 635 31 0 1 635 27066494 27065860 0.000000e+00 1002
18 TraesCS4A01G254400 chr1A 94.671 638 34 0 1 638 127800040 127799403 0.000000e+00 990
19 TraesCS4A01G254400 chr7A 95.223 628 30 0 1 628 464368133 464367506 0.000000e+00 994


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G254400 chr4A 566588200 566590644 2444 True 4516 4516 100.000 1 2445 1 chr4A.!!$R2 2444
1 TraesCS4A01G254400 chr4A 566608937 566611346 2409 True 4351 4351 99.253 1 2410 1 chr4A.!!$R3 2409
2 TraesCS4A01G254400 chr4A 101106117 101106754 637 True 996 996 94.828 1 638 1 chr4A.!!$R1 637
3 TraesCS4A01G254400 chr4A 604130587 604131221 634 True 990 990 94.803 1 635 1 chr4A.!!$R4 634
4 TraesCS4A01G254400 chr4A 476644615 476645295 680 False 974 974 92.511 1 679 1 chr4A.!!$F1 678
5 TraesCS4A01G254400 chr3A 128657771 128659595 1824 True 2933 2933 95.674 621 2445 1 chr3A.!!$R1 1824
6 TraesCS4A01G254400 chr3A 87633058 87633689 631 False 996 996 95.095 1 632 1 chr3A.!!$F1 631
7 TraesCS4A01G254400 chr2A 276858469 276860277 1808 False 2896 2896 95.455 621 2445 1 chr2A.!!$F1 1824
8 TraesCS4A01G254400 chr5A 136567991 136569791 1800 False 2806 2806 94.633 621 2445 1 chr5A.!!$F1 1824
9 TraesCS4A01G254400 chr5A 569902904 569903529 625 False 996 996 95.367 1 626 1 chr5A.!!$F2 625
10 TraesCS4A01G254400 chr3B 367031067 367032886 1819 True 2564 2564 92.143 632 2445 1 chr3B.!!$R1 1813
11 TraesCS4A01G254400 chr3B 379653319 379655133 1814 False 2536 2536 91.914 632 2445 1 chr3B.!!$F1 1813
12 TraesCS4A01G254400 chr6B 129700708 129702503 1795 False 2547 2547 92.278 650 2445 1 chr6B.!!$F1 1795
13 TraesCS4A01G254400 chr5B 328273371 328275181 1810 False 2420 2420 90.790 622 2445 1 chr5B.!!$F1 1823
14 TraesCS4A01G254400 chr5B 159191984 159192715 731 True 606 606 82.072 1 734 1 chr5B.!!$R1 733
15 TraesCS4A01G254400 chr6D 17041596 17043132 1536 True 2098 2098 91.235 888 2445 1 chr6D.!!$R1 1557
16 TraesCS4A01G254400 chr1A 27065860 27066494 634 True 1002 1002 95.118 1 635 1 chr1A.!!$R1 634
17 TraesCS4A01G254400 chr1A 127799403 127800040 637 True 990 990 94.671 1 638 1 chr1A.!!$R2 637
18 TraesCS4A01G254400 chr7A 464367506 464368133 627 True 994 994 95.223 1 628 1 chr7A.!!$R1 627

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
455 467 1.621301 CTTCTGCTGACAAGGACGCG 61.621 60.0 3.53 3.53 0.0 6.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2359 2409 4.491676 GTCGTGTGCTAGTCCAAGAATTA 58.508 43.478 0.0 0.0 0.0 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
455 467 1.621301 CTTCTGCTGACAAGGACGCG 61.621 60.000 3.53 3.53 0.00 6.01
1020 1041 0.190069 TGTACCAGGCGATCCCCTAT 59.810 55.000 0.00 0.00 32.78 2.57
2359 2409 9.093458 TCATACATGGACTTATGTGATGATAGT 57.907 33.333 0.00 0.00 41.18 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 1.994507 CTCTCCGACGCCGTCTTCAT 61.995 60.000 16.07 0.0 0.0 2.57
455 467 4.307432 TGAAACTGTCGAATGTCTTCTCC 58.693 43.478 0.00 0.0 0.0 3.71
2359 2409 4.491676 GTCGTGTGCTAGTCCAAGAATTA 58.508 43.478 0.00 0.0 0.0 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.