Multiple sequence alignment - TraesCS4A01G245600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G245600 chr4A 100.000 2270 0 0 1 2270 556011004 556008735 0.000000e+00 4193
1 TraesCS4A01G245600 chr4A 90.719 1002 71 12 624 1608 66536002 66536998 0.000000e+00 1315
2 TraesCS4A01G245600 chr4A 93.983 349 13 6 1928 2270 29436546 29436892 2.580000e-144 521
3 TraesCS4A01G245600 chr2A 94.560 2298 79 16 6 2270 161588903 161586619 0.000000e+00 3509
4 TraesCS4A01G245600 chr2A 88.419 2366 168 45 1 2270 767478063 767475708 0.000000e+00 2754
5 TraesCS4A01G245600 chr2A 93.391 348 17 4 1928 2270 52603319 52602973 5.590000e-141 510
6 TraesCS4A01G245600 chr3A 93.902 1525 74 3 1 1506 702488525 702487001 0.000000e+00 2283
7 TraesCS4A01G245600 chr3A 90.184 1630 127 17 1 1605 80569313 80570934 0.000000e+00 2093
8 TraesCS4A01G245600 chr3A 93.678 348 16 4 1928 2270 737720945 737720599 1.200000e-142 516
9 TraesCS4A01G245600 chr5A 92.346 1607 108 13 6 1602 573790833 573792434 0.000000e+00 2272
10 TraesCS4A01G245600 chr5A 91.059 1633 111 20 3 1608 459479540 459477916 0.000000e+00 2174
11 TraesCS4A01G245600 chr5A 88.411 837 51 17 1479 2270 573792462 573793297 0.000000e+00 966
12 TraesCS4A01G245600 chr1A 92.284 1607 80 12 1 1597 564250732 564252304 0.000000e+00 2241
13 TraesCS4A01G245600 chr1A 90.613 1353 103 13 273 1608 514986894 514985549 0.000000e+00 1773
14 TraesCS4A01G245600 chr1A 90.455 1341 104 13 285 1608 514738114 514736781 0.000000e+00 1746
15 TraesCS4A01G245600 chr1A 92.989 813 36 10 1479 2270 564259147 564258335 0.000000e+00 1166
16 TraesCS4A01G245600 chr1A 90.168 895 69 7 1 876 588666450 588665556 0.000000e+00 1147
17 TraesCS4A01G245600 chr1A 92.497 813 38 12 1479 2270 564252480 564253290 0.000000e+00 1142
18 TraesCS4A01G245600 chr1A 86.957 874 57 24 1451 2270 514736796 514735926 0.000000e+00 929
19 TraesCS4A01G245600 chr3D 87.213 1963 172 44 4 1925 2338198 2336274 0.000000e+00 2161
20 TraesCS4A01G245600 chr6A 90.836 1615 111 10 1 1600 21600955 21602547 0.000000e+00 2128
21 TraesCS4A01G245600 chr6A 88.369 834 46 17 1479 2270 21602573 21603397 0.000000e+00 955
22 TraesCS4A01G245600 chr7A 90.915 1607 111 15 1 1596 118423924 118425506 0.000000e+00 2126
23 TraesCS4A01G245600 chr7A 90.572 891 68 7 1 876 58357822 58358711 0.000000e+00 1166
24 TraesCS4A01G245600 chr7A 93.913 345 17 3 1928 2268 58359761 58360105 3.340000e-143 518
25 TraesCS4A01G245600 chr7A 93.372 347 17 4 1929 2270 735977791 735977446 2.010000e-140 508
26 TraesCS4A01G245600 chr7D 90.271 1069 76 13 873 1925 54727910 54726854 0.000000e+00 1373
27 TraesCS4A01G245600 chr7D 90.112 1072 83 11 873 1925 39240126 39241193 0.000000e+00 1371


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G245600 chr4A 556008735 556011004 2269 True 4193.0 4193 100.0000 1 2270 1 chr4A.!!$R1 2269
1 TraesCS4A01G245600 chr4A 66536002 66536998 996 False 1315.0 1315 90.7190 624 1608 1 chr4A.!!$F2 984
2 TraesCS4A01G245600 chr2A 161586619 161588903 2284 True 3509.0 3509 94.5600 6 2270 1 chr2A.!!$R2 2264
3 TraesCS4A01G245600 chr2A 767475708 767478063 2355 True 2754.0 2754 88.4190 1 2270 1 chr2A.!!$R3 2269
4 TraesCS4A01G245600 chr3A 702487001 702488525 1524 True 2283.0 2283 93.9020 1 1506 1 chr3A.!!$R1 1505
5 TraesCS4A01G245600 chr3A 80569313 80570934 1621 False 2093.0 2093 90.1840 1 1605 1 chr3A.!!$F1 1604
6 TraesCS4A01G245600 chr5A 459477916 459479540 1624 True 2174.0 2174 91.0590 3 1608 1 chr5A.!!$R1 1605
7 TraesCS4A01G245600 chr5A 573790833 573793297 2464 False 1619.0 2272 90.3785 6 2270 2 chr5A.!!$F1 2264
8 TraesCS4A01G245600 chr1A 514985549 514986894 1345 True 1773.0 1773 90.6130 273 1608 1 chr1A.!!$R1 1335
9 TraesCS4A01G245600 chr1A 564250732 564253290 2558 False 1691.5 2241 92.3905 1 2270 2 chr1A.!!$F1 2269
10 TraesCS4A01G245600 chr1A 514735926 514738114 2188 True 1337.5 1746 88.7060 285 2270 2 chr1A.!!$R4 1985
11 TraesCS4A01G245600 chr1A 564258335 564259147 812 True 1166.0 1166 92.9890 1479 2270 1 chr1A.!!$R2 791
12 TraesCS4A01G245600 chr1A 588665556 588666450 894 True 1147.0 1147 90.1680 1 876 1 chr1A.!!$R3 875
13 TraesCS4A01G245600 chr3D 2336274 2338198 1924 True 2161.0 2161 87.2130 4 1925 1 chr3D.!!$R1 1921
14 TraesCS4A01G245600 chr6A 21600955 21603397 2442 False 1541.5 2128 89.6025 1 2270 2 chr6A.!!$F1 2269
15 TraesCS4A01G245600 chr7A 118423924 118425506 1582 False 2126.0 2126 90.9150 1 1596 1 chr7A.!!$F1 1595
16 TraesCS4A01G245600 chr7A 58357822 58360105 2283 False 842.0 1166 92.2425 1 2268 2 chr7A.!!$F2 2267
17 TraesCS4A01G245600 chr7D 54726854 54727910 1056 True 1373.0 1373 90.2710 873 1925 1 chr7D.!!$R1 1052
18 TraesCS4A01G245600 chr7D 39240126 39241193 1067 False 1371.0 1371 90.1120 873 1925 1 chr7D.!!$F1 1052

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
107 116 2.429930 CTTCGGCACCCTTGACCA 59.570 61.111 0.0 0.0 0.0 4.02 F
166 195 3.001406 ACCCACCACTACGCCCTC 61.001 66.667 0.0 0.0 0.0 4.30 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1101 1160 0.615261 GAAAGTCCTCCGGGTCCTCT 60.615 60.000 0.0 0.0 0.0 3.69 R
2029 2704 2.829720 TGAATCCGCCTATATAAGCCGT 59.170 45.455 0.0 0.0 0.0 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 116 2.429930 CTTCGGCACCCTTGACCA 59.570 61.111 0.00 0.00 0.00 4.02
166 195 3.001406 ACCCACCACTACGCCCTC 61.001 66.667 0.00 0.00 0.00 4.30
317 353 4.759205 GGCCCGCCCCAACTTGAT 62.759 66.667 0.00 0.00 0.00 2.57
340 376 3.731766 GAGGAGGCGGAGGAGCTCT 62.732 68.421 14.64 0.00 37.29 4.09
736 777 3.523087 TTTGAGCTGTACCGCCGCA 62.523 57.895 5.57 2.17 0.00 5.69
1222 1317 3.932580 GATGACAGCGACCACGGCA 62.933 63.158 0.00 0.00 40.15 5.69
1279 1374 3.119209 GGAGGACGAGTAGTTTAGGGTTG 60.119 52.174 0.00 0.00 0.00 3.77
1441 1537 9.645059 TTGTTGAACAATCAAGTGTTTAAATCA 57.355 25.926 6.66 0.00 45.88 2.57
1883 2475 2.046314 CCGATTTCTGTGGGCCGT 60.046 61.111 0.00 0.00 0.00 5.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
94 102 2.358737 CGAGTGGTCAAGGGTGCC 60.359 66.667 0.00 0.0 0.00 5.01
97 105 2.526873 AGCCGAGTGGTCAAGGGT 60.527 61.111 0.00 0.0 37.67 4.34
219 249 1.265454 GGCGAGAAGGGGAGAAGGAA 61.265 60.000 0.00 0.0 0.00 3.36
317 353 2.519541 CCTCCGCCTCCTCGATCA 60.520 66.667 0.00 0.0 0.00 2.92
340 376 3.407967 GGGGATGCCGAAGTGGGA 61.408 66.667 0.00 0.0 45.08 4.37
994 1053 1.152963 GGTAGCCCGGCATGTCATT 60.153 57.895 13.15 0.0 0.00 2.57
996 1055 2.687200 AGGTAGCCCGGCATGTCA 60.687 61.111 13.15 0.0 35.12 3.58
1101 1160 0.615261 GAAAGTCCTCCGGGTCCTCT 60.615 60.000 0.00 0.0 0.00 3.69
1206 1280 4.228567 TTGCCGTGGTCGCTGTCA 62.229 61.111 0.00 0.0 35.54 3.58
1625 2208 2.950975 GGAGCTACTTACTAAGCCTCGT 59.049 50.000 0.00 0.0 39.64 4.18
2029 2704 2.829720 TGAATCCGCCTATATAAGCCGT 59.170 45.455 0.00 0.0 0.00 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.