Multiple sequence alignment - TraesCS4A01G245000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G245000 chr4A 100.000 2421 0 0 1 2421 554972466 554974886 0 4471
1 TraesCS4A01G245000 chr4A 98.410 1006 15 1 1417 2421 132785217 132784212 0 1768
2 TraesCS4A01G245000 chr4A 98.308 1005 16 1 1418 2421 521941758 521940754 0 1760
3 TraesCS4A01G245000 chr4A 98.090 890 16 1 1 890 554964521 554965409 0 1548
4 TraesCS4A01G245000 chr2A 98.608 1006 13 1 1417 2421 273562037 273563042 0 1779
5 TraesCS4A01G245000 chr2A 98.408 1005 13 3 1417 2419 445659283 445660286 0 1764
6 TraesCS4A01G245000 chr2A 98.312 1007 14 2 1418 2421 120754903 120755909 0 1762
7 TraesCS4A01G245000 chr2A 97.082 891 25 1 1 891 100327716 100328605 0 1500
8 TraesCS4A01G245000 chr2A 96.966 890 26 1 1 890 100319827 100320715 0 1493
9 TraesCS4A01G245000 chr7A 98.510 1007 13 2 1417 2421 482214431 482215437 0 1775
10 TraesCS4A01G245000 chr7A 98.310 1006 13 4 1419 2421 185770753 185769749 0 1760
11 TraesCS4A01G245000 chr7A 98.115 1008 17 2 1416 2421 701075809 701074802 0 1755
12 TraesCS4A01G245000 chr7A 97.416 890 22 1 1 890 363020661 363019773 0 1515
13 TraesCS4A01G245000 chr7A 97.194 891 23 2 1 891 365758479 365757591 0 1506
14 TraesCS4A01G245000 chr7A 97.079 890 25 1 1 890 363028588 363027700 0 1498
15 TraesCS4A01G245000 chr7A 96.854 890 27 1 1 890 404583658 404582770 0 1487
16 TraesCS4A01G245000 chr3A 98.510 1007 11 4 1417 2421 443140196 443139192 0 1773
17 TraesCS4A01G245000 chr1A 97.200 893 24 1 1 893 340190671 340189780 0 1509
18 TraesCS4A01G245000 chr1A 97.191 890 24 1 1 890 340182447 340181559 0 1504
19 TraesCS4A01G245000 chr1B 97.538 528 13 0 891 1418 544594446 544594973 0 904
20 TraesCS4A01G245000 chr1B 97.348 528 14 0 891 1418 80739176 80738649 0 898
21 TraesCS4A01G245000 chrUn 97.348 528 14 0 891 1418 67510033 67509506 0 898
22 TraesCS4A01G245000 chrUn 97.348 528 14 0 891 1418 199875575 199876102 0 898
23 TraesCS4A01G245000 chrUn 97.348 528 14 0 891 1418 199905495 199906022 0 898
24 TraesCS4A01G245000 chrUn 97.348 528 14 0 891 1418 291536191 291536718 0 898
25 TraesCS4A01G245000 chrUn 97.348 528 14 0 891 1418 425723672 425723145 0 898
26 TraesCS4A01G245000 chrUn 97.348 528 14 0 891 1418 442558958 442558431 0 898
27 TraesCS4A01G245000 chr5D 97.348 528 14 0 891 1418 18999675 19000202 0 898


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G245000 chr4A 554972466 554974886 2420 False 4471 4471 100.000 1 2421 1 chr4A.!!$F2 2420
1 TraesCS4A01G245000 chr4A 132784212 132785217 1005 True 1768 1768 98.410 1417 2421 1 chr4A.!!$R1 1004
2 TraesCS4A01G245000 chr4A 521940754 521941758 1004 True 1760 1760 98.308 1418 2421 1 chr4A.!!$R2 1003
3 TraesCS4A01G245000 chr4A 554964521 554965409 888 False 1548 1548 98.090 1 890 1 chr4A.!!$F1 889
4 TraesCS4A01G245000 chr2A 273562037 273563042 1005 False 1779 1779 98.608 1417 2421 1 chr2A.!!$F4 1004
5 TraesCS4A01G245000 chr2A 445659283 445660286 1003 False 1764 1764 98.408 1417 2419 1 chr2A.!!$F5 1002
6 TraesCS4A01G245000 chr2A 120754903 120755909 1006 False 1762 1762 98.312 1418 2421 1 chr2A.!!$F3 1003
7 TraesCS4A01G245000 chr2A 100327716 100328605 889 False 1500 1500 97.082 1 891 1 chr2A.!!$F2 890
8 TraesCS4A01G245000 chr2A 100319827 100320715 888 False 1493 1493 96.966 1 890 1 chr2A.!!$F1 889
9 TraesCS4A01G245000 chr7A 482214431 482215437 1006 False 1775 1775 98.510 1417 2421 1 chr7A.!!$F1 1004
10 TraesCS4A01G245000 chr7A 185769749 185770753 1004 True 1760 1760 98.310 1419 2421 1 chr7A.!!$R1 1002
11 TraesCS4A01G245000 chr7A 701074802 701075809 1007 True 1755 1755 98.115 1416 2421 1 chr7A.!!$R6 1005
12 TraesCS4A01G245000 chr7A 363019773 363020661 888 True 1515 1515 97.416 1 890 1 chr7A.!!$R2 889
13 TraesCS4A01G245000 chr7A 365757591 365758479 888 True 1506 1506 97.194 1 891 1 chr7A.!!$R4 890
14 TraesCS4A01G245000 chr7A 363027700 363028588 888 True 1498 1498 97.079 1 890 1 chr7A.!!$R3 889
15 TraesCS4A01G245000 chr7A 404582770 404583658 888 True 1487 1487 96.854 1 890 1 chr7A.!!$R5 889
16 TraesCS4A01G245000 chr3A 443139192 443140196 1004 True 1773 1773 98.510 1417 2421 1 chr3A.!!$R1 1004
17 TraesCS4A01G245000 chr1A 340189780 340190671 891 True 1509 1509 97.200 1 893 1 chr1A.!!$R2 892
18 TraesCS4A01G245000 chr1A 340181559 340182447 888 True 1504 1504 97.191 1 890 1 chr1A.!!$R1 889
19 TraesCS4A01G245000 chr1B 544594446 544594973 527 False 904 904 97.538 891 1418 1 chr1B.!!$F1 527
20 TraesCS4A01G245000 chr1B 80738649 80739176 527 True 898 898 97.348 891 1418 1 chr1B.!!$R1 527
21 TraesCS4A01G245000 chrUn 67509506 67510033 527 True 898 898 97.348 891 1418 1 chrUn.!!$R1 527
22 TraesCS4A01G245000 chrUn 199875575 199876102 527 False 898 898 97.348 891 1418 1 chrUn.!!$F1 527
23 TraesCS4A01G245000 chrUn 199905495 199906022 527 False 898 898 97.348 891 1418 1 chrUn.!!$F2 527
24 TraesCS4A01G245000 chrUn 291536191 291536718 527 False 898 898 97.348 891 1418 1 chrUn.!!$F3 527
25 TraesCS4A01G245000 chrUn 425723145 425723672 527 True 898 898 97.348 891 1418 1 chrUn.!!$R2 527
26 TraesCS4A01G245000 chrUn 442558431 442558958 527 True 898 898 97.348 891 1418 1 chrUn.!!$R3 527
27 TraesCS4A01G245000 chr5D 18999675 19000202 527 False 898 898 97.348 891 1418 1 chr5D.!!$F1 527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
910 911 0.174845 CGGCGATGTTAGGAAGTCCA 59.825 55.0 0.0 0.0 38.89 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2329 2335 3.734463 TGCCGTGTGAGTTTGAAATCTA 58.266 40.909 0.0 0.0 0.0 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 94 0.968901 TACGATCTTGTGCCCTCGGT 60.969 55.000 0.00 0.00 35.52 4.69
465 466 1.550130 CCGGAGTCCTGTTAGCCCAA 61.550 60.000 7.77 0.00 0.00 4.12
505 506 0.958382 GACTGGCCGGCATGTGTTTA 60.958 55.000 30.85 2.27 0.00 2.01
687 688 2.505819 CCTGTTCCCATAGGTTAGTGCT 59.494 50.000 0.00 0.00 0.00 4.40
728 729 2.757099 GTCGGCCCGGGTTCTCTA 60.757 66.667 24.63 0.00 0.00 2.43
780 781 1.067250 GAGCCAAAAGGCGCAAACA 59.933 52.632 10.83 0.00 40.23 2.83
910 911 0.174845 CGGCGATGTTAGGAAGTCCA 59.825 55.000 0.00 0.00 38.89 4.02
967 968 1.523154 CTGCTTAACGGCCTGCCAAA 61.523 55.000 9.17 0.00 35.37 3.28
1378 1379 2.492484 GACTCAGAACTGGTACGGACAT 59.508 50.000 0.00 0.00 38.67 3.06
1548 1552 3.884091 CAGCGGAAGGTAGACTACACTAT 59.116 47.826 14.48 0.00 41.81 2.12
1972 1976 3.532102 AGGTAGACTCCCAAACCTTCAT 58.468 45.455 0.00 0.00 39.32 2.57
1988 1992 3.991773 CCTTCATAAACTTCGTTCACCGA 59.008 43.478 0.00 0.00 45.66 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 94 4.604050 AGCCTGACTATCTACCAGATCCTA 59.396 45.833 0.00 0.00 36.20 2.94
221 222 3.438297 CTCCGAGGAGCGAGAAATAAA 57.562 47.619 6.17 0.00 44.57 1.40
465 466 2.002505 AGTGTCCTGAGCAGTAGTGT 57.997 50.000 0.00 0.00 0.00 3.55
687 688 2.419667 GCTAGTCGTTAACCCAAAGCA 58.580 47.619 0.00 0.00 0.00 3.91
728 729 3.576118 AGTGTCGCTAGCTTCCATATGAT 59.424 43.478 13.93 0.00 0.00 2.45
780 781 2.285818 TTACCATGGCCCGGGACT 60.286 61.111 30.93 10.08 0.00 3.85
967 968 1.228154 GGCTGAACCGTTTCCAGGT 60.228 57.895 3.01 0.00 45.29 4.00
1341 1342 2.035832 TGAGTCGACTGTTTCATGCTCA 59.964 45.455 25.58 7.80 0.00 4.26
1378 1379 4.310022 AATTAAACAGTCGGATTCCCCA 57.690 40.909 0.00 0.00 34.14 4.96
1548 1552 8.264347 TCATTGAATACTTGACTATGGCTTGTA 58.736 33.333 0.00 0.00 0.00 2.41
1988 1992 4.371624 TCCAAGAGACATTGTGGATTGT 57.628 40.909 0.00 0.00 35.22 2.71
2329 2335 3.734463 TGCCGTGTGAGTTTGAAATCTA 58.266 40.909 0.00 0.00 0.00 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.