Multiple sequence alignment - TraesCS4A01G228000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G228000 chr4A 100.000 2857 0 0 1 2857 536326998 536329854 0.000000e+00 5276.0
1 TraesCS4A01G228000 chr4A 84.665 626 66 13 989 1592 13064211 13063594 5.270000e-167 597.0
2 TraesCS4A01G228000 chr4A 78.458 441 75 15 348 780 101820176 101819748 1.300000e-68 270.0
3 TraesCS4A01G228000 chr4A 100.000 30 0 0 771 800 231291659 231291630 3.980000e-04 56.5
4 TraesCS4A01G228000 chr2A 98.131 2140 23 2 735 2857 740731814 740733953 0.000000e+00 3714.0
5 TraesCS4A01G228000 chr2A 97.194 1461 35 3 1403 2857 157904809 157906269 0.000000e+00 2466.0
6 TraesCS4A01G228000 chr2A 98.383 804 10 3 1 802 738826659 738827461 0.000000e+00 1410.0
7 TraesCS4A01G228000 chr2A 91.211 603 26 11 771 1364 157904229 157904813 0.000000e+00 795.0
8 TraesCS4A01G228000 chr1B 99.027 2056 17 3 803 2857 229535111 229537164 0.000000e+00 3683.0
9 TraesCS4A01G228000 chr3B 92.633 2104 124 14 771 2857 98704007 98701918 0.000000e+00 2998.0
10 TraesCS4A01G228000 chr3B 96.646 1431 32 5 1436 2857 810404761 810403338 0.000000e+00 2362.0
11 TraesCS4A01G228000 chr3B 98.327 777 12 1 1 776 615466879 615466103 0.000000e+00 1362.0
12 TraesCS4A01G228000 chr5B 91.298 2057 147 12 808 2857 190587646 190585615 0.000000e+00 2778.0
13 TraesCS4A01G228000 chr5B 100.000 29 0 0 243 271 451169953 451169925 1.000000e-03 54.7
14 TraesCS4A01G228000 chr6B 96.927 1432 34 3 1436 2857 21201660 21203091 0.000000e+00 2392.0
15 TraesCS4A01G228000 chr6B 98.444 771 7 1 1 771 430543698 430542933 0.000000e+00 1352.0
16 TraesCS4A01G228000 chr6B 96.741 491 7 2 320 802 430542800 430542311 0.000000e+00 809.0
17 TraesCS4A01G228000 chr6A 96.503 1430 35 5 1436 2857 568064114 568062692 0.000000e+00 2350.0
18 TraesCS4A01G228000 chr6A 78.621 435 73 15 348 775 87531708 87531287 1.300000e-68 270.0
19 TraesCS4A01G228000 chr2B 98.595 783 8 2 1 780 729515301 729516083 0.000000e+00 1382.0
20 TraesCS4A01G228000 chr3A 98.575 772 8 2 1 771 56080772 56081541 0.000000e+00 1362.0
21 TraesCS4A01G228000 chr3A 100.000 32 0 0 771 802 670117319 670117288 3.070000e-05 60.2
22 TraesCS4A01G228000 chr7B 92.289 817 55 6 1588 2398 263145816 263145002 0.000000e+00 1153.0
23 TraesCS4A01G228000 chr7B 93.478 460 25 3 2399 2857 263144957 263144502 0.000000e+00 678.0
24 TraesCS4A01G228000 chr7B 86.966 445 30 9 1169 1592 263146278 263145841 2.580000e-130 475.0
25 TraesCS4A01G228000 chr4D 88.119 606 58 8 992 1592 386539407 386538811 0.000000e+00 708.0
26 TraesCS4A01G228000 chr1D 79.417 515 83 16 802 1312 45060297 45060792 2.730000e-90 342.0
27 TraesCS4A01G228000 chr7A 80.973 452 65 14 332 778 13396484 13396919 3.530000e-89 339.0
28 TraesCS4A01G228000 chr4B 80.227 440 67 13 875 1312 248365526 248365105 2.140000e-81 313.0
29 TraesCS4A01G228000 chr6D 74.870 386 51 29 1168 1539 443265973 443265620 1.790000e-27 134.0
30 TraesCS4A01G228000 chr3D 84.956 113 15 1 98 208 594206651 594206539 2.330000e-21 113.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G228000 chr4A 536326998 536329854 2856 False 5276.000000 5276 100.0000 1 2857 1 chr4A.!!$F1 2856
1 TraesCS4A01G228000 chr4A 13063594 13064211 617 True 597.000000 597 84.6650 989 1592 1 chr4A.!!$R1 603
2 TraesCS4A01G228000 chr2A 740731814 740733953 2139 False 3714.000000 3714 98.1310 735 2857 1 chr2A.!!$F2 2122
3 TraesCS4A01G228000 chr2A 157904229 157906269 2040 False 1630.500000 2466 94.2025 771 2857 2 chr2A.!!$F3 2086
4 TraesCS4A01G228000 chr2A 738826659 738827461 802 False 1410.000000 1410 98.3830 1 802 1 chr2A.!!$F1 801
5 TraesCS4A01G228000 chr1B 229535111 229537164 2053 False 3683.000000 3683 99.0270 803 2857 1 chr1B.!!$F1 2054
6 TraesCS4A01G228000 chr3B 98701918 98704007 2089 True 2998.000000 2998 92.6330 771 2857 1 chr3B.!!$R1 2086
7 TraesCS4A01G228000 chr3B 810403338 810404761 1423 True 2362.000000 2362 96.6460 1436 2857 1 chr3B.!!$R3 1421
8 TraesCS4A01G228000 chr3B 615466103 615466879 776 True 1362.000000 1362 98.3270 1 776 1 chr3B.!!$R2 775
9 TraesCS4A01G228000 chr5B 190585615 190587646 2031 True 2778.000000 2778 91.2980 808 2857 1 chr5B.!!$R1 2049
10 TraesCS4A01G228000 chr6B 21201660 21203091 1431 False 2392.000000 2392 96.9270 1436 2857 1 chr6B.!!$F1 1421
11 TraesCS4A01G228000 chr6B 430542311 430543698 1387 True 1080.500000 1352 97.5925 1 802 2 chr6B.!!$R1 801
12 TraesCS4A01G228000 chr6A 568062692 568064114 1422 True 2350.000000 2350 96.5030 1436 2857 1 chr6A.!!$R2 1421
13 TraesCS4A01G228000 chr2B 729515301 729516083 782 False 1382.000000 1382 98.5950 1 780 1 chr2B.!!$F1 779
14 TraesCS4A01G228000 chr3A 56080772 56081541 769 False 1362.000000 1362 98.5750 1 771 1 chr3A.!!$F1 770
15 TraesCS4A01G228000 chr7B 263144502 263146278 1776 True 768.666667 1153 90.9110 1169 2857 3 chr7B.!!$R1 1688
16 TraesCS4A01G228000 chr4D 386538811 386539407 596 True 708.000000 708 88.1190 992 1592 1 chr4D.!!$R1 600

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
368 369 4.657969 TCTCAATGGACCAAACCCAAAAAT 59.342 37.5 0.0 0.0 37.22 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2762 2921 7.682787 ATAAGAAGAGGTGTATCCACAGAAT 57.317 36.0 0.0 0.0 43.71 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
368 369 4.657969 TCTCAATGGACCAAACCCAAAAAT 59.342 37.500 0.00 0.0 37.22 1.82
1166 1188 4.681978 GCGTCGAGGGCTGTTGGT 62.682 66.667 7.31 0.0 0.00 3.67
2762 2921 5.664457 CATGTGCTTACATAGAGACCTTCA 58.336 41.667 0.00 0.0 0.00 3.02
2835 2994 9.713684 TCCTGAGGTTCAATTTCCATAATAAAT 57.286 29.630 0.00 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 3.471244 GACGAGATCCTGGACGCCG 62.471 68.421 0.00 5.22 0.00 6.46
784 795 1.886655 GCCAACCCGGAGACTCAATTT 60.887 52.381 0.73 0.00 36.56 1.82
785 796 0.322546 GCCAACCCGGAGACTCAATT 60.323 55.000 0.73 0.00 36.56 2.32
1079 1101 2.292794 GATAACTGCCGAGCCGTCCA 62.293 60.000 0.00 0.00 0.00 4.02
1166 1188 1.713647 ACCTCCTTGTCTCCTCTCTGA 59.286 52.381 0.00 0.00 0.00 3.27
2762 2921 7.682787 ATAAGAAGAGGTGTATCCACAGAAT 57.317 36.000 0.00 0.00 43.71 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.