Multiple sequence alignment - TraesCS4A01G222100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G222100 chr4A 100.000 2642 0 0 1 2642 528646197 528643556 0.000000e+00 4879
1 TraesCS4A01G222100 chr4A 98.337 2646 28 6 1 2642 528606215 528603582 0.000000e+00 4628
2 TraesCS4A01G222100 chr4B 95.570 1106 43 4 1 1103 97923846 97922744 0.000000e+00 1766
3 TraesCS4A01G222100 chr4B 95.041 605 15 2 1057 1646 97922744 97922140 0.000000e+00 937
4 TraesCS4A01G222100 chr4B 80.577 659 103 13 2006 2641 82319752 82319096 3.950000e-133 484
5 TraesCS4A01G222100 chr4B 98.611 72 0 1 1643 1714 97922028 97921958 2.760000e-25 126
6 TraesCS4A01G222100 chr6B 86.677 1336 171 7 318 1646 63227102 63225767 0.000000e+00 1474
7 TraesCS4A01G222100 chr6B 86.527 1336 173 7 318 1646 63258106 63256771 0.000000e+00 1463
8 TraesCS4A01G222100 chr6B 79.299 314 48 3 2010 2307 691791779 691792091 1.240000e-48 204
9 TraesCS4A01G222100 chrUn 85.301 1279 141 16 391 1646 102516079 102517333 0.000000e+00 1277
10 TraesCS4A01G222100 chrUn 88.689 389 44 0 1163 1551 479944283 479943895 2.380000e-130 475
11 TraesCS4A01G222100 chr6A 86.518 1120 133 9 429 1532 34550681 34549564 0.000000e+00 1216
12 TraesCS4A01G222100 chr6A 77.778 486 82 12 2007 2475 196330454 196329978 2.590000e-70 276
13 TraesCS4A01G222100 chr6A 91.150 113 9 1 1534 1646 34548687 34548576 4.550000e-33 152
14 TraesCS4A01G222100 chr3B 83.920 653 86 10 2009 2642 788978096 788977444 8.090000e-170 606
15 TraesCS4A01G222100 chr3B 83.767 653 87 10 2009 2642 788928666 788928014 3.760000e-168 601
16 TraesCS4A01G222100 chr3B 83.614 653 88 10 2009 2642 788921807 788921155 1.750000e-166 595
17 TraesCS4A01G222100 chr7D 83.257 657 84 12 2010 2641 186394567 186395222 4.900000e-162 580
18 TraesCS4A01G222100 chr7D 82.373 295 34 4 2012 2290 151694440 151694732 9.450000e-60 241
19 TraesCS4A01G222100 chr7D 76.331 338 62 5 2007 2328 66485591 66485926 5.850000e-37 165
20 TraesCS4A01G222100 chr6D 82.083 653 93 7 2008 2638 89358078 89358728 1.080000e-148 536
21 TraesCS4A01G222100 chr7B 82.815 547 73 7 2009 2536 113526516 113527060 1.110000e-128 470
22 TraesCS4A01G222100 chr5B 79.632 653 107 12 2008 2637 577348711 577348062 1.870000e-121 446
23 TraesCS4A01G222100 chr3D 78.464 599 96 18 2070 2642 500629745 500629154 6.950000e-96 361
24 TraesCS4A01G222100 chr2D 89.706 136 13 1 2009 2144 41861103 41861237 3.500000e-39 172
25 TraesCS4A01G222100 chr1B 87.143 140 18 0 2007 2146 630349401 630349262 2.720000e-35 159
26 TraesCS4A01G222100 chr5A 85.000 140 21 0 2007 2146 692178058 692177919 2.740000e-30 143


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G222100 chr4A 528643556 528646197 2641 True 4879 4879 100.000000 1 2642 1 chr4A.!!$R2 2641
1 TraesCS4A01G222100 chr4A 528603582 528606215 2633 True 4628 4628 98.337000 1 2642 1 chr4A.!!$R1 2641
2 TraesCS4A01G222100 chr4B 97921958 97923846 1888 True 943 1766 96.407333 1 1714 3 chr4B.!!$R2 1713
3 TraesCS4A01G222100 chr4B 82319096 82319752 656 True 484 484 80.577000 2006 2641 1 chr4B.!!$R1 635
4 TraesCS4A01G222100 chr6B 63225767 63227102 1335 True 1474 1474 86.677000 318 1646 1 chr6B.!!$R1 1328
5 TraesCS4A01G222100 chr6B 63256771 63258106 1335 True 1463 1463 86.527000 318 1646 1 chr6B.!!$R2 1328
6 TraesCS4A01G222100 chrUn 102516079 102517333 1254 False 1277 1277 85.301000 391 1646 1 chrUn.!!$F1 1255
7 TraesCS4A01G222100 chr6A 34548576 34550681 2105 True 684 1216 88.834000 429 1646 2 chr6A.!!$R2 1217
8 TraesCS4A01G222100 chr3B 788977444 788978096 652 True 606 606 83.920000 2009 2642 1 chr3B.!!$R3 633
9 TraesCS4A01G222100 chr3B 788928014 788928666 652 True 601 601 83.767000 2009 2642 1 chr3B.!!$R2 633
10 TraesCS4A01G222100 chr3B 788921155 788921807 652 True 595 595 83.614000 2009 2642 1 chr3B.!!$R1 633
11 TraesCS4A01G222100 chr7D 186394567 186395222 655 False 580 580 83.257000 2010 2641 1 chr7D.!!$F3 631
12 TraesCS4A01G222100 chr6D 89358078 89358728 650 False 536 536 82.083000 2008 2638 1 chr6D.!!$F1 630
13 TraesCS4A01G222100 chr7B 113526516 113527060 544 False 470 470 82.815000 2009 2536 1 chr7B.!!$F1 527
14 TraesCS4A01G222100 chr5B 577348062 577348711 649 True 446 446 79.632000 2008 2637 1 chr5B.!!$R1 629
15 TraesCS4A01G222100 chr3D 500629154 500629745 591 True 361 361 78.464000 2070 2642 1 chr3D.!!$R1 572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
682 696 0.107703 CCTGCAAGTTCCGCCATCTA 60.108 55.0 0.0 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1956 3043 1.149401 TCACCCAATTCCACGTGCA 59.851 52.632 10.91 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
263 266 1.372748 CGCGCAATTTTCTTGGCCA 60.373 52.632 8.75 0.00 0.00 5.36
474 482 0.840722 AGTTGGTCGGACCTTCCCAT 60.841 55.000 26.41 5.55 39.58 4.00
501 509 2.191400 CCTCCTCAGAATCCTCCAACA 58.809 52.381 0.00 0.00 0.00 3.33
555 563 2.113807 AGTCTGCACATCATGGAGCTA 58.886 47.619 6.00 0.00 46.06 3.32
589 597 0.321564 CTGGCGTCCCATGTTCTTGA 60.322 55.000 0.00 0.00 41.21 3.02
619 627 1.352352 CTCATGTCTTGGACCCACCTT 59.648 52.381 0.00 0.00 39.86 3.50
682 696 0.107703 CCTGCAAGTTCCGCCATCTA 60.108 55.000 0.00 0.00 0.00 1.98
741 755 2.235898 AGGGTTGTTTTGTTGCATGTGT 59.764 40.909 0.00 0.00 0.00 3.72
1956 3043 1.917955 CGTGCGTGAAGATGAATACGT 59.082 47.619 0.00 0.00 38.67 3.57
2003 3090 2.538132 GCACATAATTGAACGGCCGTAC 60.538 50.000 34.44 10.18 0.00 3.67
2058 3148 7.699566 TCAAGTCGCAAAATAGTACAAAGTTT 58.300 30.769 0.00 0.00 0.00 2.66
2095 3185 2.492484 ACACCCTAAAACACGCACAAAA 59.508 40.909 0.00 0.00 0.00 2.44
2567 3684 1.310933 GCCGGTCGACCTCTAGACAA 61.311 60.000 30.92 0.00 39.01 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
263 266 3.502211 CCAAGTGGAAAGTTATGCGACTT 59.498 43.478 0.00 0.00 41.44 3.01
501 509 1.919600 GCATTCCTGGAGCTGGAGGT 61.920 60.000 0.00 0.00 33.24 3.85
589 597 0.687354 AAGACATGAGCCACGGTCTT 59.313 50.000 0.00 13.51 43.64 3.01
682 696 2.981859 AAGACTTGTTGACGTCCAGT 57.018 45.000 14.12 9.65 0.00 4.00
741 755 1.409241 GCCATCCATGAGAAGCTCCAA 60.409 52.381 0.00 0.00 0.00 3.53
1119 1201 6.358178 TGTCACAGTGTAAAAACTCCCATTA 58.642 36.000 0.00 0.00 0.00 1.90
1349 1431 1.203994 CGTCCGGTGATACCTTCTTGT 59.796 52.381 0.00 0.00 35.66 3.16
1887 2974 3.125487 CACGTCACAAACAGGTAACAACA 59.875 43.478 0.00 0.00 41.41 3.33
1956 3043 1.149401 TCACCCAATTCCACGTGCA 59.851 52.632 10.91 0.00 0.00 4.57
2058 3148 4.917385 AGGGTGTGCTTGTACATATCAAA 58.083 39.130 0.00 0.00 32.43 2.69
2095 3185 9.569122 TTAGGTTGCTCTTTGTTATTCTAGTTT 57.431 29.630 0.00 0.00 0.00 2.66
2567 3684 3.950254 CGAGATCGCGGGCTACGT 61.950 66.667 11.35 0.00 46.52 3.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.