Multiple sequence alignment - TraesCS4A01G222000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G222000 chr4A 100.000 2901 0 0 1 2901 528606440 528603540 0.000000e+00 5358
1 TraesCS4A01G222000 chr4A 98.352 2913 32 6 1 2901 528646422 528643514 0.000000e+00 5099
2 TraesCS4A01G222000 chr4A 95.726 117 3 2 111 227 127407768 127407654 1.370000e-43 187
3 TraesCS4A01G222000 chr4B 94.982 1116 41 3 216 1319 97923856 97922744 0.000000e+00 1736
4 TraesCS4A01G222000 chr4B 94.380 605 19 4 1273 1862 97922744 97922140 0.000000e+00 915
5 TraesCS4A01G222000 chr4B 80.204 687 110 14 2222 2885 82319752 82319069 2.600000e-135 492
6 TraesCS4A01G222000 chr4B 97.170 106 3 0 1 106 97923958 97923853 2.300000e-41 180
7 TraesCS4A01G222000 chr4B 98.611 72 0 1 1859 1930 97922028 97921958 3.030000e-25 126
8 TraesCS4A01G222000 chr6B 86.153 1336 168 7 544 1862 63227102 63225767 0.000000e+00 1426
9 TraesCS4A01G222000 chr6B 86.003 1336 170 7 544 1862 63258106 63256771 0.000000e+00 1415
10 TraesCS4A01G222000 chr6B 78.981 314 49 3 2226 2523 691791779 691792091 6.340000e-47 198
11 TraesCS4A01G222000 chr6B 82.877 146 21 4 2220 2363 146135672 146135815 8.440000e-26 128
12 TraesCS4A01G222000 chrUn 84.597 1279 140 16 617 1862 102516079 102517333 0.000000e+00 1218
13 TraesCS4A01G222000 chrUn 88.175 389 46 0 1379 1767 479944283 479943895 5.660000e-127 464
14 TraesCS4A01G222000 chrUn 96.429 112 4 0 107 218 81697236 81697125 4.940000e-43 185
15 TraesCS4A01G222000 chr6A 85.625 1120 133 9 655 1748 34550681 34549564 0.000000e+00 1151
16 TraesCS4A01G222000 chr3B 83.285 694 98 9 2225 2900 788978096 788977403 8.830000e-175 623
17 TraesCS4A01G222000 chr3B 83.141 694 99 9 2225 2900 788928666 788927973 4.110000e-173 617
18 TraesCS4A01G222000 chr3B 82.997 694 100 9 2225 2900 788921807 788921114 1.910000e-171 612
19 TraesCS4A01G222000 chr7D 82.951 698 94 11 2226 2899 186394567 186395263 8.890000e-170 606
20 TraesCS4A01G222000 chr7D 82.712 295 33 4 2228 2506 151694440 151694732 2.230000e-61 246
21 TraesCS4A01G222000 chr7D 91.971 137 5 6 88 222 280404951 280404819 1.370000e-43 187
22 TraesCS4A01G222000 chr7D 76.627 338 61 5 2223 2544 66485591 66485926 1.380000e-38 171
23 TraesCS4A01G222000 chr6D 81.170 701 101 12 2224 2901 89358078 89358770 4.260000e-148 534
24 TraesCS4A01G222000 chr6D 92.969 128 7 2 108 233 132306981 132306854 4.940000e-43 185
25 TraesCS4A01G222000 chr5B 79.601 701 117 12 2224 2901 577348711 577348014 2.020000e-131 479
26 TraesCS4A01G222000 chr7B 82.998 547 72 7 2225 2752 113526516 113527060 2.620000e-130 475
27 TraesCS4A01G222000 chr3D 87.179 390 48 2 2514 2901 360392817 360393206 2.650000e-120 442
28 TraesCS4A01G222000 chr7A 95.726 117 3 2 111 227 560407157 560407043 1.370000e-43 187
29 TraesCS4A01G222000 chr5A 95.726 117 3 2 111 227 194319256 194319142 1.370000e-43 187
30 TraesCS4A01G222000 chr5A 85.106 141 19 2 2223 2362 692178058 692177919 3.010000e-30 143
31 TraesCS4A01G222000 chr1A 94.262 122 5 2 111 232 11269133 11269014 4.940000e-43 185
32 TraesCS4A01G222000 chr1A 92.857 126 9 0 103 228 48980806 48980931 1.780000e-42 183
33 TraesCS4A01G222000 chr2D 88.971 136 14 1 2225 2360 41861103 41861237 1.790000e-37 167
34 TraesCS4A01G222000 chr1B 86.429 140 19 0 2223 2362 630349401 630349262 1.390000e-33 154


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G222000 chr4A 528603540 528606440 2900 True 5358.00 5358 100.00000 1 2901 1 chr4A.!!$R2 2900
1 TraesCS4A01G222000 chr4A 528643514 528646422 2908 True 5099.00 5099 98.35200 1 2901 1 chr4A.!!$R3 2900
2 TraesCS4A01G222000 chr4B 97921958 97923958 2000 True 739.25 1736 96.28575 1 1930 4 chr4B.!!$R2 1929
3 TraesCS4A01G222000 chr4B 82319069 82319752 683 True 492.00 492 80.20400 2222 2885 1 chr4B.!!$R1 663
4 TraesCS4A01G222000 chr6B 63225767 63227102 1335 True 1426.00 1426 86.15300 544 1862 1 chr6B.!!$R1 1318
5 TraesCS4A01G222000 chr6B 63256771 63258106 1335 True 1415.00 1415 86.00300 544 1862 1 chr6B.!!$R2 1318
6 TraesCS4A01G222000 chrUn 102516079 102517333 1254 False 1218.00 1218 84.59700 617 1862 1 chrUn.!!$F1 1245
7 TraesCS4A01G222000 chr6A 34549564 34550681 1117 True 1151.00 1151 85.62500 655 1748 1 chr6A.!!$R1 1093
8 TraesCS4A01G222000 chr3B 788977403 788978096 693 True 623.00 623 83.28500 2225 2900 1 chr3B.!!$R3 675
9 TraesCS4A01G222000 chr3B 788927973 788928666 693 True 617.00 617 83.14100 2225 2900 1 chr3B.!!$R2 675
10 TraesCS4A01G222000 chr3B 788921114 788921807 693 True 612.00 612 82.99700 2225 2900 1 chr3B.!!$R1 675
11 TraesCS4A01G222000 chr7D 186394567 186395263 696 False 606.00 606 82.95100 2226 2899 1 chr7D.!!$F3 673
12 TraesCS4A01G222000 chr6D 89358078 89358770 692 False 534.00 534 81.17000 2224 2901 1 chr6D.!!$F1 677
13 TraesCS4A01G222000 chr5B 577348014 577348711 697 True 479.00 479 79.60100 2224 2901 1 chr5B.!!$R1 677
14 TraesCS4A01G222000 chr7B 113526516 113527060 544 False 475.00 475 82.99800 2225 2752 1 chr7B.!!$F1 527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
815 822 0.606401 CTGGCGTCCCATGTTCTTGT 60.606 55.0 0.0 0.0 41.21 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2173 2393 1.963855 TCACCCAATTCCACGTGCG 60.964 57.895 10.91 3.66 0.0 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 4.523173 TCTGTAAGTCGACCTCAATCTTGT 59.477 41.667 13.01 0.00 33.76 3.16
384 386 9.198475 AGATTTCATTCTTCTTAAGGATTGCAT 57.802 29.630 1.85 0.00 0.00 3.96
489 491 2.435737 CGCGCAATTTTCTTGGCCG 61.436 57.895 8.75 0.00 0.00 6.13
494 496 1.269448 GCAATTTTCTTGGCCGAGTCA 59.731 47.619 19.96 5.23 0.00 3.41
757 764 1.345415 CCAGGAATGCCTTGCTTTTGT 59.655 47.619 0.00 0.00 43.90 2.83
815 822 0.606401 CTGGCGTCCCATGTTCTTGT 60.606 55.000 0.00 0.00 41.21 3.16
1361 1452 4.578516 TGGGAGTTTTTACACTGTGACATG 59.421 41.667 15.86 0.00 0.00 3.21
1419 1510 0.482446 ATGGACCAACAAAGGAGGCA 59.518 50.000 0.00 0.00 0.00 4.75
1459 1550 8.964772 GTACCTATTCAAGTGTTCTTACTAGGA 58.035 37.037 0.00 0.00 34.91 2.94
1627 1733 1.883926 TCGTTGGACTGAATCACTCGA 59.116 47.619 0.00 0.00 0.00 4.04
1846 1952 6.156775 TGTTCCTTCAGAGATATGGATCACAA 59.843 38.462 0.00 0.00 34.17 3.33
2783 3033 0.824759 GCCGGTTGACCTCTAGACAT 59.175 55.000 1.90 0.00 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 2.418368 AATGGCTAAATGGTCGAGCA 57.582 45.000 21.02 21.02 37.98 4.26
180 181 5.533528 TCGGAATTACTTGTCTCGGATATGA 59.466 40.000 0.00 0.00 0.00 2.15
187 188 2.597305 CCGTTCGGAATTACTTGTCTCG 59.403 50.000 5.19 0.00 0.00 4.04
384 386 8.257306 AGCAAGGAAACAAAACTTCATCTTTTA 58.743 29.630 0.00 0.00 0.00 1.52
489 491 5.063880 ACCAAGTGGAAAGTTATGTGACTC 58.936 41.667 3.83 0.00 38.94 3.36
494 496 5.659079 TGGAAAACCAAGTGGAAAGTTATGT 59.341 36.000 3.83 0.00 38.94 2.29
757 764 3.865446 CTCCATGATGTGCAGACTAACA 58.135 45.455 0.00 0.00 0.00 2.41
815 822 1.204704 CAAGACATGAGCCACGGTCTA 59.795 52.381 0.00 0.00 39.55 2.59
1627 1733 5.414765 GGAAATTCTTCGAGGGTAAACATGT 59.585 40.000 0.00 0.00 31.77 3.21
1846 1952 6.214819 ACTGGCCCCAAGTATTATATATTCGT 59.785 38.462 0.00 0.00 0.00 3.85
2104 2324 2.349275 ACGTCACAAACAGGTAACAACG 59.651 45.455 0.00 0.00 41.41 4.10
2173 2393 1.963855 TCACCCAATTCCACGTGCG 60.964 57.895 10.91 3.66 0.00 5.34
2246 2468 7.803189 ACTTTGTACTATTTTGCGACTTGAATG 59.197 33.333 0.00 0.00 0.00 2.67
2770 3020 2.573369 GGCTACGATGTCTAGAGGTCA 58.427 52.381 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.