Multiple sequence alignment - TraesCS4A01G215400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G215400 chr4A 100.000 2436 0 0 1 2436 513923801 513921366 0 4499
1 TraesCS4A01G215400 chr4A 96.604 2444 71 8 1 2436 81354126 81351687 0 4043
2 TraesCS4A01G215400 chr4A 96.443 2446 74 9 1 2436 6136775 6139217 0 4023
3 TraesCS4A01G215400 chr7A 96.649 2447 67 10 1 2436 618748473 618746031 0 4050
4 TraesCS4A01G215400 chr7A 96.483 2445 76 6 1 2436 645171797 645174240 0 4030
5 TraesCS4A01G215400 chr6A 96.563 2444 72 7 1 2436 73419157 73421596 0 4037
6 TraesCS4A01G215400 chr6A 96.522 2444 73 6 1 2436 474617305 474619744 0 4032
7 TraesCS4A01G215400 chr3A 96.481 2444 75 8 1 2436 328583622 328586062 0 4026
8 TraesCS4A01G215400 chr3A 96.443 2446 75 7 1 2436 576841486 576839043 0 4024
9 TraesCS4A01G215400 chr5A 96.442 2445 74 9 1 2436 150511895 150514335 0 4021


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G215400 chr4A 513921366 513923801 2435 True 4499 4499 100.000 1 2436 1 chr4A.!!$R2 2435
1 TraesCS4A01G215400 chr4A 81351687 81354126 2439 True 4043 4043 96.604 1 2436 1 chr4A.!!$R1 2435
2 TraesCS4A01G215400 chr4A 6136775 6139217 2442 False 4023 4023 96.443 1 2436 1 chr4A.!!$F1 2435
3 TraesCS4A01G215400 chr7A 618746031 618748473 2442 True 4050 4050 96.649 1 2436 1 chr7A.!!$R1 2435
4 TraesCS4A01G215400 chr7A 645171797 645174240 2443 False 4030 4030 96.483 1 2436 1 chr7A.!!$F1 2435
5 TraesCS4A01G215400 chr6A 73419157 73421596 2439 False 4037 4037 96.563 1 2436 1 chr6A.!!$F1 2435
6 TraesCS4A01G215400 chr6A 474617305 474619744 2439 False 4032 4032 96.522 1 2436 1 chr6A.!!$F2 2435
7 TraesCS4A01G215400 chr3A 328583622 328586062 2440 False 4026 4026 96.481 1 2436 1 chr3A.!!$F1 2435
8 TraesCS4A01G215400 chr3A 576839043 576841486 2443 True 4024 4024 96.443 1 2436 1 chr3A.!!$R1 2435
9 TraesCS4A01G215400 chr5A 150511895 150514335 2440 False 4021 4021 96.442 1 2436 1 chr5A.!!$F1 2435

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
383 386 1.893315 TTTGGAGGCCTAGGCATACT 58.107 50.000 34.09 22.29 44.11 2.12 F
469 472 3.507622 CCTAAAACCCTGGAAGCTTCTTG 59.492 47.826 25.05 17.04 0.00 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1227 1235 1.483595 CCAGAGGCACCAGAGGACAA 61.484 60.000 0.00 0.0 0.00 3.18 R
2163 2179 3.333029 AAATTACAGGCCATTTGCACC 57.667 42.857 5.01 0.0 43.89 5.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
270 272 3.737559 AAATGGGCAGTGAACCTCATA 57.262 42.857 0.00 0.00 0.00 2.15
383 386 1.893315 TTTGGAGGCCTAGGCATACT 58.107 50.000 34.09 22.29 44.11 2.12
469 472 3.507622 CCTAAAACCCTGGAAGCTTCTTG 59.492 47.826 25.05 17.04 0.00 3.02
490 493 5.043737 TGTTGCCCATAAATACCTAGGAC 57.956 43.478 17.98 0.00 0.00 3.85
647 652 4.142381 GGAAGATACTTGGTTTGGCACATC 60.142 45.833 0.00 0.00 39.30 3.06
1234 1242 3.243907 ACACTGTTAGCTCAGTTGTCCTC 60.244 47.826 5.36 0.00 44.92 3.71
1257 1265 5.036117 TGGTGCCTCTGGAAATATAGAAC 57.964 43.478 0.00 0.00 0.00 3.01
1259 1267 5.903010 TGGTGCCTCTGGAAATATAGAACTA 59.097 40.000 0.00 0.00 0.00 2.24
1580 1589 1.738099 CGCTTGCTTACTGGTCGCT 60.738 57.895 0.00 0.00 0.00 4.93
1590 1599 3.889134 CTGGTCGCTGCAGGCTGAA 62.889 63.158 20.86 6.92 39.13 3.02
1691 1700 1.804151 GCACCGCTCAAGTGATTTGTA 59.196 47.619 0.00 0.00 37.42 2.41
1723 1734 1.633945 ACTTGTTCATCCACCCCCTAC 59.366 52.381 0.00 0.00 0.00 3.18
1838 1849 6.349694 GGAGATGCTCCCTGTTTTTCTAAAAG 60.350 42.308 1.97 0.00 44.36 2.27
1981 1997 2.079170 TCCTGGATTGTTTTGGCACA 57.921 45.000 0.00 0.00 0.00 4.57
2163 2179 6.306356 CCAGCAAAATTGTGTATTTCGAGAAG 59.694 38.462 0.00 0.00 35.39 2.85
2379 2401 0.916086 TGTGGGCCAATAGGTCGAAT 59.084 50.000 8.40 0.00 41.80 3.34
2381 2403 1.141053 GTGGGCCAATAGGTCGAATCT 59.859 52.381 8.40 0.00 41.80 2.40
2386 2408 4.262894 GGGCCAATAGGTCGAATCTAATGA 60.263 45.833 4.39 0.00 41.80 2.57
2388 2410 5.409826 GGCCAATAGGTCGAATCTAATGAAG 59.590 44.000 0.00 1.36 37.19 3.02
2389 2411 5.106908 GCCAATAGGTCGAATCTAATGAAGC 60.107 44.000 11.50 5.98 37.19 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
270 272 8.242053 CACAAGCAATGAGACATCTAAGAATTT 58.758 33.333 0.00 0.00 0.00 1.82
383 386 8.934023 ACAGATGTTAATTTCTTGGAGGTTAA 57.066 30.769 0.00 0.00 0.00 2.01
469 472 5.043737 TGTCCTAGGTATTTATGGGCAAC 57.956 43.478 9.08 0.00 28.69 4.17
559 563 4.392445 GCCAAATTTCACAGCATGCATAAA 59.608 37.500 21.98 13.90 42.53 1.40
875 881 7.677745 AGTTGATAACATGATAGAGGGAGCTAT 59.322 37.037 0.00 0.00 33.91 2.97
1091 1099 9.113838 CCAGAGATGTTTAGCAACTATACATTT 57.886 33.333 10.63 6.56 38.21 2.32
1227 1235 1.483595 CCAGAGGCACCAGAGGACAA 61.484 60.000 0.00 0.00 0.00 3.18
1234 1242 4.963318 TCTATATTTCCAGAGGCACCAG 57.037 45.455 0.00 0.00 0.00 4.00
1257 1265 8.478877 AGGAGGTGTTACTGAAAATCATAGTAG 58.521 37.037 0.00 0.00 0.00 2.57
1259 1267 7.106239 CAGGAGGTGTTACTGAAAATCATAGT 58.894 38.462 0.00 0.00 34.21 2.12
1516 1524 3.434309 CATGGTGGATGTCCCTCTTTTT 58.566 45.455 0.00 0.00 35.38 1.94
1691 1700 7.337942 GGTGGATGAACAAGTTCTCTGAATAAT 59.662 37.037 13.49 0.00 40.14 1.28
1981 1997 9.965824 CTTTTGTACACAATCACTAGGATTTTT 57.034 29.630 0.00 0.00 43.76 1.94
2163 2179 3.333029 AAATTACAGGCCATTTGCACC 57.667 42.857 5.01 0.00 43.89 5.01
2379 2401 5.957842 AAATTGACAACGGCTTCATTAGA 57.042 34.783 0.00 0.00 0.00 2.10
2381 2403 6.428465 TGACTAAATTGACAACGGCTTCATTA 59.572 34.615 0.00 0.00 0.00 1.90
2386 2408 4.336993 TGTTGACTAAATTGACAACGGCTT 59.663 37.500 0.00 0.00 42.39 4.35
2388 2410 4.217754 TGTTGACTAAATTGACAACGGC 57.782 40.909 0.00 0.00 42.39 5.68
2389 2411 6.915300 TCATTTGTTGACTAAATTGACAACGG 59.085 34.615 0.00 0.00 42.39 4.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.