Multiple sequence alignment - TraesCS4A01G212500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G212500 chr4A 100.000 2550 0 0 1 2550 508275503 508272954 0.000000e+00 4710.0
1 TraesCS4A01G212500 chr4A 95.065 1155 56 1 514 1668 508358758 508357605 0.000000e+00 1816.0
2 TraesCS4A01G212500 chr4A 95.069 1156 53 2 514 1668 508495088 508493936 0.000000e+00 1816.0
3 TraesCS4A01G212500 chr4A 90.234 727 55 7 1 724 597877944 597878657 0.000000e+00 935.0
4 TraesCS4A01G212500 chr4A 88.571 735 72 9 1 727 7474241 7473511 0.000000e+00 881.0
5 TraesCS4A01G212500 chr6B 97.630 886 18 3 1665 2550 719968208 719967326 0.000000e+00 1517.0
6 TraesCS4A01G212500 chr6B 97.222 756 16 1 1669 2424 716637554 716638304 0.000000e+00 1275.0
7 TraesCS4A01G212500 chr7B 97.532 851 16 1 1670 2520 378406437 378407282 0.000000e+00 1450.0
8 TraesCS4A01G212500 chr7B 99.206 126 0 1 2425 2550 645657487 645657611 2.550000e-55 226.0
9 TraesCS4A01G212500 chr7B 96.970 132 3 1 2419 2550 66629994 66630124 1.190000e-53 220.0
10 TraesCS4A01G212500 chr5B 96.005 751 24 2 1669 2419 90201861 90201117 0.000000e+00 1216.0
11 TraesCS4A01G212500 chr5B 88.658 723 73 4 3 725 81598767 81599480 0.000000e+00 872.0
12 TraesCS4A01G212500 chr5B 84.105 497 69 10 1039 1531 610301050 610301540 2.970000e-129 472.0
13 TraesCS4A01G212500 chr5B 76.295 502 77 24 1001 1474 610305388 610305875 1.970000e-56 230.0
14 TraesCS4A01G212500 chr5B 79.701 335 55 10 1143 1474 610499607 610499931 1.970000e-56 230.0
15 TraesCS4A01G212500 chr5B 98.425 127 2 0 2424 2550 488836058 488836184 9.180000e-55 224.0
16 TraesCS4A01G212500 chr2B 96.729 642 21 0 1670 2311 728226390 728227031 0.000000e+00 1070.0
17 TraesCS4A01G212500 chr2B 83.069 189 26 2 2237 2424 385568948 385568765 1.570000e-37 167.0
18 TraesCS4A01G212500 chr4B 91.417 769 56 5 880 1641 109222279 109223044 0.000000e+00 1046.0
19 TraesCS4A01G212500 chr4B 97.692 130 2 1 2421 2550 555290730 555290602 3.300000e-54 222.0
20 TraesCS4A01G212500 chr4B 92.523 107 8 0 725 831 109222157 109222263 1.220000e-33 154.0
21 TraesCS4A01G212500 chr1D 91.989 724 54 2 1 724 428688686 428689405 0.000000e+00 1013.0
22 TraesCS4A01G212500 chr7D 91.678 733 52 7 1 728 18059424 18060152 0.000000e+00 1007.0
23 TraesCS4A01G212500 chr7D 84.959 246 23 11 2310 2550 230072291 230072527 1.180000e-58 237.0
24 TraesCS4A01G212500 chr7D 81.140 228 33 6 2201 2424 552951402 552951623 9.380000e-40 174.0
25 TraesCS4A01G212500 chr7D 96.296 54 1 1 1669 1721 610762291 610762238 1.260000e-13 87.9
26 TraesCS4A01G212500 chr7A 90.822 730 56 7 1 724 7840537 7841261 0.000000e+00 966.0
27 TraesCS4A01G212500 chrUn 90.759 725 60 5 1 724 101610217 101610935 0.000000e+00 961.0
28 TraesCS4A01G212500 chrUn 96.992 133 3 1 2418 2550 372855068 372854937 3.300000e-54 222.0
29 TraesCS4A01G212500 chr5A 90.398 729 56 10 1 722 568672077 568672798 0.000000e+00 946.0
30 TraesCS4A01G212500 chr5A 89.986 719 61 7 11 724 568685227 568685939 0.000000e+00 918.0
31 TraesCS4A01G212500 chr5A 77.218 496 79 17 1001 1472 617206721 617207206 2.520000e-65 259.0
32 TraesCS4A01G212500 chr5D 85.400 500 60 12 1039 1531 494189106 494189599 8.140000e-140 507.0
33 TraesCS4A01G212500 chr5D 76.346 520 82 22 978 1474 494215575 494216076 9.120000e-60 241.0
34 TraesCS4A01G212500 chr3A 84.511 368 51 4 1669 2035 24488156 24488518 2.410000e-95 359.0
35 TraesCS4A01G212500 chr3A 80.543 221 33 8 2201 2419 501866798 501866586 7.300000e-36 161.0
36 TraesCS4A01G212500 chr3A 84.177 158 25 0 2045 2202 24507063 24507220 1.220000e-33 154.0
37 TraesCS4A01G212500 chr1B 85.333 225 26 5 2201 2424 546861836 546861618 2.550000e-55 226.0
38 TraesCS4A01G212500 chr1B 80.435 230 30 11 2200 2424 540995411 540995630 7.300000e-36 161.0
39 TraesCS4A01G212500 chr3B 95.683 139 5 1 2412 2550 92943703 92943566 3.300000e-54 222.0
40 TraesCS4A01G212500 chr2D 95.833 96 4 0 1669 1764 616214965 616215060 3.400000e-34 156.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G212500 chr4A 508272954 508275503 2549 True 4710 4710 100.000 1 2550 1 chr4A.!!$R2 2549
1 TraesCS4A01G212500 chr4A 508357605 508358758 1153 True 1816 1816 95.065 514 1668 1 chr4A.!!$R3 1154
2 TraesCS4A01G212500 chr4A 508493936 508495088 1152 True 1816 1816 95.069 514 1668 1 chr4A.!!$R4 1154
3 TraesCS4A01G212500 chr4A 597877944 597878657 713 False 935 935 90.234 1 724 1 chr4A.!!$F1 723
4 TraesCS4A01G212500 chr4A 7473511 7474241 730 True 881 881 88.571 1 727 1 chr4A.!!$R1 726
5 TraesCS4A01G212500 chr6B 719967326 719968208 882 True 1517 1517 97.630 1665 2550 1 chr6B.!!$R1 885
6 TraesCS4A01G212500 chr6B 716637554 716638304 750 False 1275 1275 97.222 1669 2424 1 chr6B.!!$F1 755
7 TraesCS4A01G212500 chr7B 378406437 378407282 845 False 1450 1450 97.532 1670 2520 1 chr7B.!!$F2 850
8 TraesCS4A01G212500 chr5B 90201117 90201861 744 True 1216 1216 96.005 1669 2419 1 chr5B.!!$R1 750
9 TraesCS4A01G212500 chr5B 81598767 81599480 713 False 872 872 88.658 3 725 1 chr5B.!!$F1 722
10 TraesCS4A01G212500 chr5B 610301050 610305875 4825 False 351 472 80.200 1001 1531 2 chr5B.!!$F4 530
11 TraesCS4A01G212500 chr2B 728226390 728227031 641 False 1070 1070 96.729 1670 2311 1 chr2B.!!$F1 641
12 TraesCS4A01G212500 chr4B 109222157 109223044 887 False 600 1046 91.970 725 1641 2 chr4B.!!$F1 916
13 TraesCS4A01G212500 chr1D 428688686 428689405 719 False 1013 1013 91.989 1 724 1 chr1D.!!$F1 723
14 TraesCS4A01G212500 chr7D 18059424 18060152 728 False 1007 1007 91.678 1 728 1 chr7D.!!$F1 727
15 TraesCS4A01G212500 chr7A 7840537 7841261 724 False 966 966 90.822 1 724 1 chr7A.!!$F1 723
16 TraesCS4A01G212500 chrUn 101610217 101610935 718 False 961 961 90.759 1 724 1 chrUn.!!$F1 723
17 TraesCS4A01G212500 chr5A 568672077 568672798 721 False 946 946 90.398 1 722 1 chr5A.!!$F1 721
18 TraesCS4A01G212500 chr5A 568685227 568685939 712 False 918 918 89.986 11 724 1 chr5A.!!$F2 713
19 TraesCS4A01G212500 chr5D 494215575 494216076 501 False 241 241 76.346 978 1474 1 chr5D.!!$F2 496

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
632 647 1.501582 GACTAGACAGGGCTGGGATT 58.498 55.0 0.00 0.0 34.19 3.01 F
875 895 1.558741 GTTGGTGACGACGTGTAACA 58.441 50.0 4.58 0.0 33.02 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1534 1562 2.177394 TGGATTAAACGAGCAGTGCA 57.823 45.000 19.2 0.0 0.00 4.57 R
2026 2054 6.037610 GCACTAACGATTCAGGAAGAAATGAT 59.962 38.462 0.0 0.0 40.22 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 2.993220 CCGTCGTGATCACTTTCAATCA 59.007 45.455 22.95 0.00 0.00 2.57
70 71 3.618594 CCGTCGTGATCACTTTCAATCAT 59.381 43.478 22.95 0.00 34.60 2.45
73 74 5.163963 CGTCGTGATCACTTTCAATCATGAA 60.164 40.000 22.95 0.00 44.99 2.57
115 119 7.017750 ACCTAGCTAGATCTGTGATTACCTCTA 59.982 40.741 22.70 0.00 0.00 2.43
275 280 4.157120 GCCTGTGCCGTCGGGTAT 62.157 66.667 14.38 0.00 36.33 2.73
543 554 7.835682 TGAATGATTGGATTCAACAGGTCTTAT 59.164 33.333 0.00 0.00 39.00 1.73
604 619 1.672881 ACTGTACGTATACGGTCTGGC 59.327 52.381 27.62 11.77 46.14 4.85
632 647 1.501582 GACTAGACAGGGCTGGGATT 58.498 55.000 0.00 0.00 34.19 3.01
648 663 2.653953 GATTTAGGCTACGGCGGGCA 62.654 60.000 23.52 8.03 39.81 5.36
695 715 7.557358 GGGATAAAAATACCCTTCGGAAACTAA 59.443 37.037 0.00 0.00 40.39 2.24
875 895 1.558741 GTTGGTGACGACGTGTAACA 58.441 50.000 4.58 0.00 33.02 2.41
1058 1085 2.039624 AGATGTGACCCTCCGGCT 59.960 61.111 0.00 0.00 0.00 5.52
1302 1330 4.770874 GGGTACATGGTGGCGCGT 62.771 66.667 8.43 0.00 0.00 6.01
1375 1403 1.911766 GTGTTCGGGGAGGTGGAGA 60.912 63.158 0.00 0.00 0.00 3.71
1405 1433 4.101448 GTGGAGGCGCTGGTGGAT 62.101 66.667 7.64 0.00 0.00 3.41
1445 1473 2.044650 GCATGCTGGAGAAGGCCA 60.045 61.111 11.37 0.00 36.30 5.36
1534 1562 1.198713 ACAGCTTCATCTCCACGGAT 58.801 50.000 0.00 0.00 0.00 4.18
2026 2054 3.014623 CCAGCGTCCCGTCTATATATGA 58.985 50.000 0.00 0.00 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 5.625150 AGGTTTTGTAGTGCTTCTCTTCAT 58.375 37.500 0.00 0.00 0.00 2.57
70 71 5.036117 AGGTTTTGTAGTGCTTCTCTTCA 57.964 39.130 0.00 0.00 0.00 3.02
73 74 4.284746 AGCTAGGTTTTGTAGTGCTTCTCT 59.715 41.667 0.00 0.00 0.00 3.10
115 119 2.856222 CTAACCTAGGTATCCGACGGT 58.144 52.381 16.67 3.95 0.00 4.83
184 188 1.093159 CTAGGGTTCACGTAGCGTCT 58.907 55.000 0.00 0.00 38.32 4.18
365 373 2.584608 GCACAGGTACCGCATCCT 59.415 61.111 6.18 0.00 33.96 3.24
543 554 1.607178 ACACGACCCCACGACCATA 60.607 57.895 0.00 0.00 37.03 2.74
582 597 3.499918 GCCAGACCGTATACGTACAGTAT 59.500 47.826 22.87 8.85 46.90 2.12
604 619 4.279671 CAGCCCTGTCTAGTCCTGTATAAG 59.720 50.000 0.00 0.00 0.00 1.73
632 647 3.379865 CTTGCCCGCCGTAGCCTAA 62.380 63.158 0.00 0.00 34.57 2.69
695 715 1.686110 CCGGTGCTCCTCCCTAACT 60.686 63.158 2.85 0.00 0.00 2.24
875 895 1.620819 ACAAGACTCCAAGAGCATCGT 59.379 47.619 0.00 0.00 42.67 3.73
1534 1562 2.177394 TGGATTAAACGAGCAGTGCA 57.823 45.000 19.20 0.00 0.00 4.57
1898 1926 6.129115 GCAACATCGTCGTACAGTTAAACTAA 60.129 38.462 0.00 0.00 0.00 2.24
2026 2054 6.037610 GCACTAACGATTCAGGAAGAAATGAT 59.962 38.462 0.00 0.00 40.22 2.45
2071 2099 9.196552 GCAAAATAAATTCAGCTAGTCTTTGTT 57.803 29.630 0.00 0.00 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.