Multiple sequence alignment - TraesCS4A01G198400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G198400 chr4A 100.000 3486 0 0 1 3486 484096808 484100293 0.000000e+00 6438
1 TraesCS4A01G198400 chr5A 96.093 3353 108 17 1 3343 368429448 368426109 0.000000e+00 5445
2 TraesCS4A01G198400 chr5A 94.997 3358 148 17 1 3350 171369481 171366136 0.000000e+00 5252
3 TraesCS4A01G198400 chr5A 98.639 147 2 0 3340 3486 368426068 368425922 9.600000e-66 261
4 TraesCS4A01G198400 chr5A 97.959 147 3 0 3340 3486 171366103 171365957 4.470000e-64 255
5 TraesCS4A01G198400 chr6A 95.806 3362 121 18 1 3350 142102793 142106146 0.000000e+00 5409
6 TraesCS4A01G198400 chr6A 95.201 3355 139 17 1 3343 249828800 249825456 0.000000e+00 5284
7 TraesCS4A01G198400 chr6A 97.959 147 3 0 3340 3486 490170304 490170158 4.470000e-64 255
8 TraesCS4A01G198400 chr2A 95.506 3360 132 17 1 3350 109291155 109287805 0.000000e+00 5350
9 TraesCS4A01G198400 chr2A 95.480 3363 129 21 1 3350 230716171 230719523 0.000000e+00 5347
10 TraesCS4A01G198400 chr2A 95.265 3358 141 16 1 3350 369290878 369294225 0.000000e+00 5304
11 TraesCS4A01G198400 chr2A 97.333 150 4 0 3337 3486 369294255 369294404 4.470000e-64 255
12 TraesCS4A01G198400 chr7A 94.890 3366 147 21 1 3350 426098578 426095222 0.000000e+00 5240
13 TraesCS4A01G198400 chr3A 94.709 3364 146 21 1 3350 240521752 240518407 0.000000e+00 5197
14 TraesCS4A01G198400 chr3A 97.333 150 2 1 3337 3486 521386612 521386759 1.610000e-63 254
15 TraesCS4A01G198400 chr1A 98.000 150 3 0 3337 3486 404666972 404667121 9.600000e-66 261
16 TraesCS4A01G198400 chr1A 97.987 149 1 1 3340 3486 277136824 277136676 1.240000e-64 257
17 TraesCS4A01G198400 chr1A 97.333 150 4 0 3337 3486 75549361 75549510 4.470000e-64 255
18 TraesCS4A01G198400 chr1A 97.333 150 3 1 3337 3486 366077773 366077921 1.610000e-63 254


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G198400 chr4A 484096808 484100293 3485 False 6438.0 6438 100.000 1 3486 1 chr4A.!!$F1 3485
1 TraesCS4A01G198400 chr5A 368425922 368429448 3526 True 2853.0 5445 97.366 1 3486 2 chr5A.!!$R2 3485
2 TraesCS4A01G198400 chr5A 171365957 171369481 3524 True 2753.5 5252 96.478 1 3486 2 chr5A.!!$R1 3485
3 TraesCS4A01G198400 chr6A 142102793 142106146 3353 False 5409.0 5409 95.806 1 3350 1 chr6A.!!$F1 3349
4 TraesCS4A01G198400 chr6A 249825456 249828800 3344 True 5284.0 5284 95.201 1 3343 1 chr6A.!!$R1 3342
5 TraesCS4A01G198400 chr2A 109287805 109291155 3350 True 5350.0 5350 95.506 1 3350 1 chr2A.!!$R1 3349
6 TraesCS4A01G198400 chr2A 230716171 230719523 3352 False 5347.0 5347 95.480 1 3350 1 chr2A.!!$F1 3349
7 TraesCS4A01G198400 chr2A 369290878 369294404 3526 False 2779.5 5304 96.299 1 3486 2 chr2A.!!$F2 3485
8 TraesCS4A01G198400 chr7A 426095222 426098578 3356 True 5240.0 5240 94.890 1 3350 1 chr7A.!!$R1 3349
9 TraesCS4A01G198400 chr3A 240518407 240521752 3345 True 5197.0 5197 94.709 1 3350 1 chr3A.!!$R1 3349

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
240 247 0.303493 CACACCTCAACAAACGGTCG 59.697 55.000 0.0 0.0 0.0 4.79 F
387 399 1.070909 CAAATTTCAAAACCGCACGCC 60.071 47.619 0.0 0.0 0.0 5.68 F
749 762 2.336667 CATTTGAATTGGACGGTTGCC 58.663 47.619 0.0 0.0 0.0 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2189 2214 0.110509 CACTTGTGCTGCATGTCGAC 60.111 55.000 9.11 9.11 33.82 4.20 R
2386 2414 5.812642 GTCGATGTTCTTCCATGACTTGTAT 59.187 40.000 0.00 0.00 0.00 2.29 R
2612 2640 7.693952 ACGTGATATAAATAGGCAAACTTGTG 58.306 34.615 0.00 0.00 0.00 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
157 162 7.861630 TCTGACAAGTTCAACTACTAAAATGC 58.138 34.615 0.00 0.00 32.21 3.56
160 165 8.462811 TGACAAGTTCAACTACTAAAATGCAAA 58.537 29.630 0.00 0.00 0.00 3.68
167 172 8.555166 TCAACTACTAAAATGCAAAAAGTTCG 57.445 30.769 0.00 0.00 0.00 3.95
240 247 0.303493 CACACCTCAACAAACGGTCG 59.697 55.000 0.00 0.00 0.00 4.79
265 272 6.296803 GGTCGTAAAATAATCTCAATCCCCT 58.703 40.000 0.00 0.00 0.00 4.79
273 280 6.776887 ATAATCTCAATCCCCTCAAGACAT 57.223 37.500 0.00 0.00 0.00 3.06
387 399 1.070909 CAAATTTCAAAACCGCACGCC 60.071 47.619 0.00 0.00 0.00 5.68
471 483 7.597288 ACAAAAACTATAAAGGCCTGACTTT 57.403 32.000 5.69 0.00 42.83 2.66
691 704 5.450818 AGTGGGATTTAGCAGGTCATAAA 57.549 39.130 0.00 0.00 0.00 1.40
749 762 2.336667 CATTTGAATTGGACGGTTGCC 58.663 47.619 0.00 0.00 0.00 4.52
1091 1111 3.691342 CGTCCCCGGTGAGAAGCA 61.691 66.667 0.00 0.00 0.00 3.91
1286 1306 3.002583 TCCACAGATGGCGGCAGA 61.003 61.111 19.29 4.88 46.80 4.26
1701 1723 6.384224 TCTTGATGCACATGTTTCTCAAATC 58.616 36.000 0.00 0.00 0.00 2.17
1822 1845 8.943002 CAAGCAGCACATATATCATTGAATCTA 58.057 33.333 0.00 0.00 0.00 1.98
1919 1943 7.206687 GTGTGGTTGAATTTAATTTCAGGACA 58.793 34.615 11.46 11.95 36.97 4.02
2189 2214 2.484264 GAGATCAACCCCAACAACTTCG 59.516 50.000 0.00 0.00 0.00 3.79
2386 2414 1.537348 GGAATAGATGCGTACGCCACA 60.537 52.381 35.11 19.22 41.09 4.17
2403 2431 4.009675 GCCACATACAAGTCATGGAAGAA 58.990 43.478 0.00 0.00 31.69 2.52
2404 2432 4.142600 GCCACATACAAGTCATGGAAGAAC 60.143 45.833 0.00 0.00 31.69 3.01
2612 2640 2.621055 TGTTATGTGTGTCAGGGTTTGC 59.379 45.455 0.00 0.00 0.00 3.68
2635 2663 7.479980 TGCACAAGTTTGCCTATTTATATCAC 58.520 34.615 7.32 0.00 42.25 3.06
2851 2882 5.980116 CGCTCAGTACAGCTTAGACATTTAT 59.020 40.000 3.94 0.00 37.25 1.40
2946 2977 3.257375 AGGACTACTAACAACATCGTGCA 59.743 43.478 0.00 0.00 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
135 140 8.850454 TTTGCATTTTAGTAGTTGAACTTGTC 57.150 30.769 1.97 0.00 0.00 3.18
240 247 5.472478 GGGGATTGAGATTATTTTACGACCC 59.528 44.000 0.00 0.00 0.00 4.46
326 338 2.165998 GCCTGACTGATCCTGCTTTTT 58.834 47.619 0.00 0.00 0.00 1.94
512 524 2.203437 GTGCCCCGGGAGTTGTTT 60.203 61.111 26.32 0.00 0.00 2.83
691 704 4.960938 TGACTTGTCTTGTCAAGCTGTAT 58.039 39.130 7.78 0.00 45.86 2.29
749 762 1.303643 GGGTGGTGGCCTTGAAGAG 60.304 63.158 3.32 0.00 0.00 2.85
818 831 4.595538 GCGTGGGTGTGGTCGTCA 62.596 66.667 0.00 0.00 0.00 4.35
1091 1111 4.084287 TGTGAGGGTTCTTATGTACTCGT 58.916 43.478 0.00 0.00 0.00 4.18
1360 1380 9.419297 GTACTAGTACAACAGATGAATGAACAA 57.581 33.333 25.02 0.00 36.15 2.83
1898 1922 8.711457 CACAATGTCCTGAAATTAAATTCAACC 58.289 33.333 7.35 0.00 38.75 3.77
1919 1943 7.534723 TGTAGTCCAGAAACTAGTACACAAT 57.465 36.000 0.00 0.00 32.52 2.71
2189 2214 0.110509 CACTTGTGCTGCATGTCGAC 60.111 55.000 9.11 9.11 33.82 4.20
2386 2414 5.812642 GTCGATGTTCTTCCATGACTTGTAT 59.187 40.000 0.00 0.00 0.00 2.29
2612 2640 7.693952 ACGTGATATAAATAGGCAAACTTGTG 58.306 34.615 0.00 0.00 0.00 3.33
3338 3420 4.437239 ACGTCATCTCTAGCCAGATTTTG 58.563 43.478 0.00 0.00 30.07 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.