Multiple sequence alignment - TraesCS4A01G197100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G197100 chr4A 100.000 2464 0 0 1 2464 479431999 479429536 0.000000e+00 4551.0
1 TraesCS4A01G197100 chr4A 97.926 2459 50 1 1 2458 480558691 480556233 0.000000e+00 4257.0
2 TraesCS4A01G197100 chr4A 95.659 1912 68 8 560 2458 479625131 479623222 0.000000e+00 3057.0
3 TraesCS4A01G197100 chr4A 94.555 1910 94 6 560 2464 479903919 479902015 0.000000e+00 2942.0
4 TraesCS4A01G197100 chr4A 91.627 1899 140 6 560 2458 481065151 481063272 0.000000e+00 2608.0
5 TraesCS4A01G197100 chr4A 100.000 559 0 0 2696 3254 479429304 479428746 0.000000e+00 1033.0
6 TraesCS4A01G197100 chr4A 92.226 566 32 6 1 565 479904504 479903950 0.000000e+00 791.0
7 TraesCS4A01G197100 chr4A 91.511 483 36 2 1976 2458 479620970 479620493 0.000000e+00 660.0
8 TraesCS4A01G197100 chr4A 93.396 424 27 1 143 565 479647908 479647485 7.660000e-176 627.0
9 TraesCS4A01G197100 chr4A 98.344 302 5 0 560 861 479647454 479647153 6.180000e-147 531.0
10 TraesCS4A01G197100 chr4A 94.895 333 14 3 233 562 479625496 479625164 4.810000e-143 518.0
11 TraesCS4A01G197100 chr4A 92.286 350 24 3 216 562 481065533 481065184 8.110000e-136 494.0
12 TraesCS4A01G197100 chr4A 94.231 52 3 0 3203 3254 479900662 479900611 2.690000e-11 80.5
13 TraesCS4A01G197100 chr4A 92.308 52 4 0 2696 2747 479615142 479615091 1.250000e-09 75.0
14 TraesCS4A01G197100 chr4D 96.158 1900 67 4 560 2458 96711739 96713633 0.000000e+00 3099.0
15 TraesCS4A01G197100 chr4D 91.028 1917 135 13 560 2458 96892075 96893972 0.000000e+00 2553.0
16 TraesCS4A01G197100 chr4D 94.444 360 14 2 208 562 96711347 96711705 1.710000e-152 549.0
17 TraesCS4A01G197100 chr4D 93.855 358 19 3 207 562 96891685 96892041 1.330000e-148 536.0
18 TraesCS4A01G197100 chr4D 97.872 47 1 0 3208 3254 96894538 96894584 7.480000e-12 82.4
19 TraesCS4A01G197100 chr4B 91.069 2329 148 27 155 2454 137701620 137703917 0.000000e+00 3094.0
20 TraesCS4A01G197100 chr4B 96.097 1486 54 1 979 2464 138276147 138277628 0.000000e+00 2420.0
21 TraesCS4A01G197100 chr4B 98.390 559 9 0 2696 3254 138277658 138278216 0.000000e+00 983.0
22 TraesCS4A01G197100 chr4B 89.200 500 21 15 507 983 138275734 138276223 7.770000e-166 593.0
23 TraesCS4A01G197100 chr4B 84.195 329 41 7 155 478 138275418 138275740 3.150000e-80 309.0
24 TraesCS4A01G197100 chr4B 94.444 54 3 0 3201 3254 137705187 137705240 2.080000e-12 84.2
25 TraesCS4A01G197100 chr7B 86.852 1293 156 10 979 2267 20721572 20720290 0.000000e+00 1434.0
26 TraesCS4A01G197100 chr7A 86.381 1285 162 10 979 2258 79335044 79333768 0.000000e+00 1391.0
27 TraesCS4A01G197100 chr3A 94.845 97 2 2 2743 2836 700747622 700747718 7.270000e-32 148.0
28 TraesCS4A01G197100 chr1B 91.765 85 7 0 2746 2830 70183205 70183121 5.700000e-23 119.0
29 TraesCS4A01G197100 chr5B 87.097 93 9 2 2746 2836 30655927 30656018 5.740000e-18 102.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G197100 chr4A 479428746 479431999 3253 True 2792.000000 4551 100.000000 1 3254 2 chr4A.!!$R3 3253
1 TraesCS4A01G197100 chr4A 480556233 480558691 2458 True 4257.000000 4257 97.926000 1 2458 1 chr4A.!!$R2 2457
2 TraesCS4A01G197100 chr4A 481063272 481065533 2261 True 1551.000000 2608 91.956500 216 2458 2 chr4A.!!$R7 2242
3 TraesCS4A01G197100 chr4A 479620493 479625496 5003 True 1411.666667 3057 94.021667 233 2458 3 chr4A.!!$R4 2225
4 TraesCS4A01G197100 chr4A 479900611 479904504 3893 True 1271.166667 2942 93.670667 1 3254 3 chr4A.!!$R6 3253
5 TraesCS4A01G197100 chr4A 479647153 479647908 755 True 579.000000 627 95.870000 143 861 2 chr4A.!!$R5 718
6 TraesCS4A01G197100 chr4D 96711347 96713633 2286 False 1824.000000 3099 95.301000 208 2458 2 chr4D.!!$F1 2250
7 TraesCS4A01G197100 chr4D 96891685 96894584 2899 False 1057.133333 2553 94.251667 207 3254 3 chr4D.!!$F2 3047
8 TraesCS4A01G197100 chr4B 137701620 137705240 3620 False 1589.100000 3094 92.756500 155 3254 2 chr4B.!!$F1 3099
9 TraesCS4A01G197100 chr4B 138275418 138278216 2798 False 1076.250000 2420 91.970500 155 3254 4 chr4B.!!$F2 3099
10 TraesCS4A01G197100 chr7B 20720290 20721572 1282 True 1434.000000 1434 86.852000 979 2267 1 chr7B.!!$R1 1288
11 TraesCS4A01G197100 chr7A 79333768 79335044 1276 True 1391.000000 1391 86.381000 979 2258 1 chr7A.!!$R1 1279

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
65 66 0.601311 ACAGAGGCAGTGAACGAAGC 60.601 55.000 0.00 0.0 0.00 3.86 F
1256 1468 2.028130 CGCAGAGAAGAGGGTCTACAT 58.972 52.381 0.00 0.0 0.00 2.29 F
1791 2003 2.159841 CGCCACGAGGAATATAATTGCG 60.160 50.000 1.86 0.0 36.89 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1126 1338 0.747255 CTGCAGAGGCTGGTATACGT 59.253 55.000 8.42 0.0 41.91 3.57 R
2178 2393 2.116125 GGCCAGCTGGACCAAAGT 59.884 61.111 37.21 0.0 37.19 2.66 R
3064 3758 2.482721 CCTTTTCAATGTAACTCGCCGT 59.517 45.455 0.00 0.0 0.00 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 0.601311 ACAGAGGCAGTGAACGAAGC 60.601 55.000 0.00 0.00 0.00 3.86
1256 1468 2.028130 CGCAGAGAAGAGGGTCTACAT 58.972 52.381 0.00 0.00 0.00 2.29
1791 2003 2.159841 CGCCACGAGGAATATAATTGCG 60.160 50.000 1.86 0.00 36.89 4.85
1835 2047 4.175962 TCTGAGTACAAGGGGGAATTCTT 58.824 43.478 5.23 0.00 0.00 2.52
1926 2141 4.919774 TGAGGAGCCCATAGTTAAAACA 57.080 40.909 0.00 0.00 0.00 2.83
1992 2207 5.517770 GCTTGTGGAAATAAATAGCTTGCAG 59.482 40.000 0.00 0.00 0.00 4.41
2178 2393 0.407918 GGGAGGAAATTGTGTCCCCA 59.592 55.000 7.71 0.00 42.72 4.96
2440 2659 3.788227 TGGAAATGGTGCTCTACAACT 57.212 42.857 0.00 0.00 36.69 3.16
2900 3161 6.233905 TCTGCATTAACTAGCTATTGGACA 57.766 37.500 0.00 0.00 0.00 4.02
3102 3797 4.982241 AAAGGAGGAAGATTGTCACTCA 57.018 40.909 0.00 0.00 0.00 3.41
3148 3843 2.048503 GAACGCTACTGTGGCCGT 60.049 61.111 10.67 8.88 0.00 5.68
3161 3856 1.134175 GTGGCCGTCATATTTGTTGGG 59.866 52.381 0.00 0.00 0.00 4.12
3171 3866 2.973694 ATTTGTTGGGATGCTCATGC 57.026 45.000 0.00 0.00 40.20 4.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 3.449018 ACTGCCTCTGTGATCGTTAGATT 59.551 43.478 0.00 0.0 37.19 2.40
130 131 1.713830 GTATTGGAGTGCGCCGTTC 59.286 57.895 4.18 0.0 0.00 3.95
201 202 1.631595 GCGAGCGAACGATTCCTTC 59.368 57.895 5.91 0.0 35.09 3.46
1126 1338 0.747255 CTGCAGAGGCTGGTATACGT 59.253 55.000 8.42 0.0 41.91 3.57
1256 1468 2.237893 GGTGGATCCGGGAGAGTTAAAA 59.762 50.000 7.39 0.0 0.00 1.52
1791 2003 3.285484 ACTGTGAATGGCAATCTCATCC 58.715 45.455 7.68 0.0 0.00 3.51
1938 2153 5.935206 TGCTTCCATATCGACTTTGTGTAAA 59.065 36.000 0.00 0.0 0.00 2.01
1992 2207 3.305110 CCCAAGAAACAACACGTTATGC 58.695 45.455 0.00 0.0 36.59 3.14
2178 2393 2.116125 GGCCAGCTGGACCAAAGT 59.884 61.111 37.21 0.0 37.19 2.66
2217 2432 6.216569 TGACAGATTCAACACTGTAAGACTC 58.783 40.000 0.00 0.0 45.54 3.36
3064 3758 2.482721 CCTTTTCAATGTAACTCGCCGT 59.517 45.455 0.00 0.0 0.00 5.68
3148 3843 4.038282 GCATGAGCATCCCAACAAATATGA 59.962 41.667 0.00 0.0 41.58 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.