Multiple sequence alignment - TraesCS4A01G181500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G181500 chr4A 100.000 2456 0 0 1 2456 456335315 456337770 0.000000e+00 4536.0
1 TraesCS4A01G181500 chr4A 99.071 1507 12 1 1 1507 457567305 457568809 0.000000e+00 2704.0
2 TraesCS4A01G181500 chr4A 98.539 958 14 0 1499 2456 457570131 457571088 0.000000e+00 1692.0
3 TraesCS4A01G181500 chr4A 84.173 695 86 14 882 1573 456293850 456294523 0.000000e+00 652.0
4 TraesCS4A01G181500 chr4A 96.407 167 6 0 1777 1943 456342012 456342178 2.410000e-70 276.0
5 TraesCS4A01G181500 chr4A 96.407 167 6 0 1777 1943 457575328 457575494 2.410000e-70 276.0
6 TraesCS4A01G181500 chr4B 93.220 1475 72 15 200 1662 179750346 179751804 0.000000e+00 2145.0
7 TraesCS4A01G181500 chr4B 86.299 562 63 11 1009 1567 179842567 179842017 1.260000e-167 599.0
8 TraesCS4A01G181500 chr4B 93.720 207 12 1 5 211 179749894 179750099 2.370000e-80 309.0
9 TraesCS4A01G181500 chr4B 74.371 437 102 7 1976 2407 62431554 62431123 6.980000e-41 178.0
10 TraesCS4A01G181500 chr4B 95.789 95 4 0 1650 1744 179751928 179752022 1.180000e-33 154.0
11 TraesCS4A01G181500 chr4D 93.985 1330 58 14 296 1618 117663748 117662434 0.000000e+00 1993.0
12 TraesCS4A01G181500 chr4D 88.571 560 55 7 1009 1567 117706361 117705810 0.000000e+00 671.0
13 TraesCS4A01G181500 chr4D 94.163 257 12 1 4 260 117664000 117663747 2.960000e-104 388.0
14 TraesCS4A01G181500 chr4D 93.382 136 9 0 1616 1751 117662127 117661992 4.140000e-48 202.0
15 TraesCS4A01G181500 chr4D 79.839 124 21 4 202 322 470797380 470797502 1.210000e-13 87.9
16 TraesCS4A01G181500 chr4D 92.453 53 3 1 257 309 379776490 379776541 9.420000e-10 75.0
17 TraesCS4A01G181500 chr5B 94.118 680 39 1 1777 2456 276949826 276950504 0.000000e+00 1033.0
18 TraesCS4A01G181500 chr5B 92.274 686 42 4 1777 2456 594328798 594329478 0.000000e+00 963.0
19 TraesCS4A01G181500 chr5B 94.611 167 7 2 1777 1943 276954738 276954902 8.710000e-65 257.0
20 TraesCS4A01G181500 chr5A 90.762 682 55 5 1777 2456 264288582 264289257 0.000000e+00 904.0
21 TraesCS4A01G181500 chr2A 90.162 681 60 4 1777 2456 104939986 104940660 0.000000e+00 880.0
22 TraesCS4A01G181500 chr3B 87.408 683 75 10 1777 2456 759960024 759959350 0.000000e+00 774.0
23 TraesCS4A01G181500 chr7B 82.889 637 82 13 903 1525 700630470 700629847 4.620000e-152 547.0
24 TraesCS4A01G181500 chr7B 81.086 534 72 16 1056 1573 700685539 700685019 1.370000e-107 399.0
25 TraesCS4A01G181500 chr7D 82.273 660 89 14 860 1504 611445273 611444627 1.660000e-151 545.0
26 TraesCS4A01G181500 chr7D 81.096 730 90 20 856 1573 611459229 611458536 7.730000e-150 540.0
27 TraesCS4A01G181500 chr7A 73.288 438 105 9 1973 2404 711804416 711804847 1.520000e-32 150.0
28 TraesCS4A01G181500 chr2B 73.791 393 96 5 2018 2407 635197665 635197277 5.470000e-32 148.0
29 TraesCS4A01G181500 chr2B 84.874 119 14 2 233 348 109955446 109955329 1.540000e-22 117.0
30 TraesCS4A01G181500 chrUn 89.381 113 11 1 237 348 287774911 287775023 9.160000e-30 141.0
31 TraesCS4A01G181500 chrUn 89.381 113 11 1 237 348 297964067 297964179 9.160000e-30 141.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G181500 chr4A 456335315 456337770 2455 False 4536.000000 4536 100.000000 1 2456 1 chr4A.!!$F2 2455
1 TraesCS4A01G181500 chr4A 457567305 457571088 3783 False 2198.000000 2704 98.805000 1 2456 2 chr4A.!!$F5 2455
2 TraesCS4A01G181500 chr4A 456293850 456294523 673 False 652.000000 652 84.173000 882 1573 1 chr4A.!!$F1 691
3 TraesCS4A01G181500 chr4B 179749894 179752022 2128 False 869.333333 2145 94.243000 5 1744 3 chr4B.!!$F1 1739
4 TraesCS4A01G181500 chr4B 179842017 179842567 550 True 599.000000 599 86.299000 1009 1567 1 chr4B.!!$R2 558
5 TraesCS4A01G181500 chr4D 117661992 117664000 2008 True 861.000000 1993 93.843333 4 1751 3 chr4D.!!$R2 1747
6 TraesCS4A01G181500 chr4D 117705810 117706361 551 True 671.000000 671 88.571000 1009 1567 1 chr4D.!!$R1 558
7 TraesCS4A01G181500 chr5B 276949826 276950504 678 False 1033.000000 1033 94.118000 1777 2456 1 chr5B.!!$F1 679
8 TraesCS4A01G181500 chr5B 594328798 594329478 680 False 963.000000 963 92.274000 1777 2456 1 chr5B.!!$F3 679
9 TraesCS4A01G181500 chr5A 264288582 264289257 675 False 904.000000 904 90.762000 1777 2456 1 chr5A.!!$F1 679
10 TraesCS4A01G181500 chr2A 104939986 104940660 674 False 880.000000 880 90.162000 1777 2456 1 chr2A.!!$F1 679
11 TraesCS4A01G181500 chr3B 759959350 759960024 674 True 774.000000 774 87.408000 1777 2456 1 chr3B.!!$R1 679
12 TraesCS4A01G181500 chr7B 700629847 700630470 623 True 547.000000 547 82.889000 903 1525 1 chr7B.!!$R1 622
13 TraesCS4A01G181500 chr7B 700685019 700685539 520 True 399.000000 399 81.086000 1056 1573 1 chr7B.!!$R2 517
14 TraesCS4A01G181500 chr7D 611444627 611445273 646 True 545.000000 545 82.273000 860 1504 1 chr7D.!!$R1 644
15 TraesCS4A01G181500 chr7D 611458536 611459229 693 True 540.000000 540 81.096000 856 1573 1 chr7D.!!$R2 717

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
81 82 1.075525 TGCCGCTAGGGTAGGTGAT 60.076 57.895 6.02 0.0 38.44 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1834 3964 0.738389 CGTTTGGCAACTCCACACTT 59.262 50.0 0.0 0.0 46.55 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.075525 TGCCGCTAGGGTAGGTGAT 60.076 57.895 6.02 0.00 38.44 3.06
336 600 5.351740 GCCGATAGAATAAATTAGGCAGGTC 59.648 44.000 0.00 0.00 42.57 3.85
893 1175 1.925185 CTCGCGCTCCATATCATCATG 59.075 52.381 5.56 0.00 0.00 3.07
1539 3214 9.794685 GATCGATCACATTCACATACTATGTAT 57.205 33.333 20.52 0.00 42.70 2.29
1579 3264 0.036765 TTGCTCGCACGATAACCCTT 60.037 50.000 0.00 0.00 0.00 3.95
1765 3895 2.969990 ACAGTCTAATCACTGCTGCTG 58.030 47.619 4.89 4.89 46.81 4.41
1834 3964 9.811995 GTGTTACAGAGTACAACATATATGGAA 57.188 33.333 16.96 0.00 34.89 3.53
1987 4124 0.620556 GGAGGATGTTCAGGCTGGAA 59.379 55.000 15.73 4.99 0.00 3.53
2134 4271 0.459899 TCTCGATATGCTTGGTGCGT 59.540 50.000 0.00 0.00 46.63 5.24
2372 4509 2.758423 AGGAACACACAAAACCCAGAAC 59.242 45.455 0.00 0.00 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.841302 AAAGAGGCCTCATCACCGCA 61.841 55.000 33.90 0.00 0.00 5.69
893 1175 1.282875 GTGTGCCTTGAAGCGGTTC 59.717 57.895 20.13 20.13 34.65 3.62
1539 3214 6.873076 AGCAAAACAAAGAAAGAATGAACACA 59.127 30.769 0.00 0.00 0.00 3.72
1579 3264 7.576861 TCTGTACACGTATCCATAGAAATCA 57.423 36.000 0.00 0.00 0.00 2.57
1834 3964 0.738389 CGTTTGGCAACTCCACACTT 59.262 50.000 0.00 0.00 46.55 3.16
2134 4271 1.072489 TGTAACCCCGTTCAGCATCAA 59.928 47.619 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.