Multiple sequence alignment - TraesCS4A01G174000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G174000 chr4A 100.000 2957 0 0 1 2957 443784236 443781280 0.000000e+00 5461.0
1 TraesCS4A01G174000 chr4A 98.513 2958 42 2 1 2957 443712233 443709277 0.000000e+00 5217.0
2 TraesCS4A01G174000 chr4A 84.375 64 10 0 32 95 321432835 321432772 2.460000e-06 63.9
3 TraesCS4A01G174000 chrUn 98.513 2958 42 2 1 2957 278529819 278526863 0.000000e+00 5217.0
4 TraesCS4A01G174000 chrUn 92.216 167 13 0 99 265 106075227 106075061 1.370000e-58 237.0
5 TraesCS4A01G174000 chr3B 94.148 2700 141 12 266 2957 678122977 678120287 0.000000e+00 4095.0
6 TraesCS4A01G174000 chr5D 94.040 2718 131 18 266 2957 28961845 28964557 0.000000e+00 4093.0
7 TraesCS4A01G174000 chr5D 89.631 2141 189 19 831 2957 468325184 468327305 0.000000e+00 2693.0
8 TraesCS4A01G174000 chr5D 89.444 2141 192 21 831 2957 374298809 374300929 0.000000e+00 2671.0
9 TraesCS4A01G174000 chr5D 93.413 167 10 1 99 265 218481761 218481926 2.280000e-61 246.0
10 TraesCS4A01G174000 chr5D 90.341 176 16 1 90 265 218459270 218459444 2.290000e-56 230.0
11 TraesCS4A01G174000 chr5D 89.231 65 7 0 32 96 233401893 233401957 6.790000e-12 82.4
12 TraesCS4A01G174000 chr5D 97.826 46 1 0 51 96 413491964 413492009 2.440000e-11 80.5
13 TraesCS4A01G174000 chr4B 93.817 2701 152 11 266 2957 589025975 589023281 0.000000e+00 4048.0
14 TraesCS4A01G174000 chr4B 93.748 2703 152 12 266 2957 588964258 588961562 0.000000e+00 4039.0
15 TraesCS4A01G174000 chr4B 91.842 1422 94 6 266 1666 629289985 629291405 0.000000e+00 1964.0
16 TraesCS4A01G174000 chr4B 86.885 61 4 4 1 57 504277615 504277675 6.840000e-07 65.8
17 TraesCS4A01G174000 chr1D 89.626 2140 190 19 831 2957 410690751 410688631 0.000000e+00 2693.0
18 TraesCS4A01G174000 chr1A 87.514 897 92 14 266 1149 568684732 568685621 0.000000e+00 1018.0
19 TraesCS4A01G174000 chr1A 87.043 903 98 13 266 1156 568686991 568686096 0.000000e+00 1002.0
20 TraesCS4A01G174000 chr2D 92.486 173 12 1 93 265 345890551 345890722 2.280000e-61 246.0
21 TraesCS4A01G174000 chr2D 92.814 167 12 0 99 265 524341570 524341404 2.940000e-60 243.0
22 TraesCS4A01G174000 chr4D 93.168 161 10 1 105 265 47934816 47934657 4.930000e-58 235.0
23 TraesCS4A01G174000 chr4D 92.216 167 12 1 99 265 450545084 450545249 4.930000e-58 235.0
24 TraesCS4A01G174000 chr4D 96.923 65 2 0 32 96 126587383 126587447 3.120000e-20 110.0
25 TraesCS4A01G174000 chr4D 87.302 63 8 0 33 95 292915896 292915958 4.090000e-09 73.1
26 TraesCS4A01G174000 chr6B 87.692 65 8 0 32 96 300239214 300239278 3.160000e-10 76.8
27 TraesCS4A01G174000 chr1B 100.000 41 0 0 1 41 313372294 313372334 3.160000e-10 76.8
28 TraesCS4A01G174000 chr1B 95.652 46 2 0 51 96 518189529 518189484 1.140000e-09 75.0
29 TraesCS4A01G174000 chr6A 97.561 41 1 0 1 41 373776338 373776378 1.470000e-08 71.3
30 TraesCS4A01G174000 chr7A 88.889 54 4 2 1 54 209963494 209963443 6.840000e-07 65.8
31 TraesCS4A01G174000 chr2A 90.196 51 4 1 1 50 675390847 675390797 6.840000e-07 65.8
32 TraesCS4A01G174000 chr5B 85.075 67 5 4 1 65 548298149 548298212 2.460000e-06 63.9
33 TraesCS4A01G174000 chr5B 88.679 53 4 2 1 52 621198005 621198056 2.460000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G174000 chr4A 443781280 443784236 2956 True 5461 5461 100.000 1 2957 1 chr4A.!!$R3 2956
1 TraesCS4A01G174000 chr4A 443709277 443712233 2956 True 5217 5217 98.513 1 2957 1 chr4A.!!$R2 2956
2 TraesCS4A01G174000 chrUn 278526863 278529819 2956 True 5217 5217 98.513 1 2957 1 chrUn.!!$R2 2956
3 TraesCS4A01G174000 chr3B 678120287 678122977 2690 True 4095 4095 94.148 266 2957 1 chr3B.!!$R1 2691
4 TraesCS4A01G174000 chr5D 28961845 28964557 2712 False 4093 4093 94.040 266 2957 1 chr5D.!!$F1 2691
5 TraesCS4A01G174000 chr5D 468325184 468327305 2121 False 2693 2693 89.631 831 2957 1 chr5D.!!$F7 2126
6 TraesCS4A01G174000 chr5D 374298809 374300929 2120 False 2671 2671 89.444 831 2957 1 chr5D.!!$F5 2126
7 TraesCS4A01G174000 chr4B 589023281 589025975 2694 True 4048 4048 93.817 266 2957 1 chr4B.!!$R2 2691
8 TraesCS4A01G174000 chr4B 588961562 588964258 2696 True 4039 4039 93.748 266 2957 1 chr4B.!!$R1 2691
9 TraesCS4A01G174000 chr4B 629289985 629291405 1420 False 1964 1964 91.842 266 1666 1 chr4B.!!$F2 1400
10 TraesCS4A01G174000 chr1D 410688631 410690751 2120 True 2693 2693 89.626 831 2957 1 chr1D.!!$R1 2126
11 TraesCS4A01G174000 chr1A 568684732 568685621 889 False 1018 1018 87.514 266 1149 1 chr1A.!!$F1 883
12 TraesCS4A01G174000 chr1A 568686096 568686991 895 True 1002 1002 87.043 266 1156 1 chr1A.!!$R1 890

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
560 571 0.249447 CCGATGCGCTTCATGACCTA 60.249 55.0 21.52 0.0 35.05 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2556 2604 9.173021 CACTTTGACAATTGTAGGGAACATATA 57.827 33.333 11.95 0.0 38.1 0.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
560 571 0.249447 CCGATGCGCTTCATGACCTA 60.249 55.000 21.52 0.00 35.05 3.08
736 749 7.754851 TTGTTTGTCTAACCCTAGGAAATTC 57.245 36.000 11.48 0.00 35.81 2.17
880 910 8.512138 GGTAGCAACATGTCAAGTAAGTTTTAT 58.488 33.333 0.00 0.00 0.00 1.40
1255 1298 4.268359 AGAGATCAATTGGGAAGAGCAAC 58.732 43.478 5.42 0.00 0.00 4.17
1877 1922 4.159557 AGAAAAGTTGTGGCCCATAATGT 58.840 39.130 0.00 0.00 0.00 2.71
2138 2183 5.163499 CCTCCAAGTATCTCAAGTCTACCAC 60.163 48.000 0.00 0.00 0.00 4.16
2490 2538 7.636150 AGTGGGACATGATTAAATCAAGAAG 57.364 36.000 0.00 0.00 44.52 2.85
2547 2595 7.222000 AGTTCTCACTACAAGACTCTTAAGG 57.778 40.000 1.85 0.00 0.00 2.69
2556 2604 8.218488 ACTACAAGACTCTTAAGGGTTTGATTT 58.782 33.333 24.71 12.97 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 164 4.446413 GTGGGTCGTACCAGGCCG 62.446 72.222 0.00 0.0 42.20 6.13
237 238 0.322008 CCCTGAGGAGGTCTTTGTGC 60.322 60.000 0.00 0.0 37.73 4.57
356 358 6.929446 TCCCATTAGGAAATTTAGGGGTTA 57.071 37.500 7.99 0.0 43.78 2.85
553 564 1.950007 CGACGAGGCGATAGGTCAT 59.050 57.895 0.00 0.0 0.00 3.06
736 749 3.144506 TCTAGTCTTACCGAATAGCCCG 58.855 50.000 0.00 0.0 39.52 6.13
1255 1298 9.243105 TCTCCTTTTACCTGGATCAAATTTAAG 57.757 33.333 0.00 0.0 0.00 1.85
2556 2604 9.173021 CACTTTGACAATTGTAGGGAACATATA 57.827 33.333 11.95 0.0 38.10 0.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.