Multiple sequence alignment - TraesCS4A01G156400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G156400 chr4A 100.000 2321 0 0 1 2321 311671013 311668693 0 4287
1 TraesCS4A01G156400 chr4A 95.882 850 28 1 2 844 640974982 640975831 0 1369
2 TraesCS4A01G156400 chr7A 97.340 2331 52 3 1 2321 94445675 94443345 0 3952
3 TraesCS4A01G156400 chr7A 96.856 2290 60 4 41 2321 665977683 665979969 0 3819
4 TraesCS4A01G156400 chr7A 97.023 1881 46 3 1 1873 546231936 546233814 0 3155
5 TraesCS4A01G156400 chr5A 97.080 2329 59 3 1 2321 30143736 30146063 0 3916
6 TraesCS4A01G156400 chr5A 96.911 1133 28 1 1 1126 375869497 375868365 0 1892
7 TraesCS4A01G156400 chr2D 96.661 2336 62 4 1 2321 63681697 63684031 0 3868
8 TraesCS4A01G156400 chr2A 97.160 2289 57 2 41 2321 690342196 690344484 0 3860
9 TraesCS4A01G156400 chr3A 96.479 2329 72 4 1 2321 740090427 740088101 0 3838
10 TraesCS4A01G156400 chr3A 96.855 2289 64 2 41 2321 60827737 60825449 0 3821
11 TraesCS4A01G156400 chr7D 96.574 2277 62 4 60 2321 463977644 463979919 0 3759
12 TraesCS4A01G156400 chr7D 95.200 750 29 5 1 749 501826062 501825319 0 1179
13 TraesCS4A01G156400 chr7D 96.375 469 10 1 1 462 49877355 49877823 0 765
14 TraesCS4A01G156400 chr1A 95.240 2332 95 5 1 2320 72584813 72587140 0 3677
15 TraesCS4A01G156400 chr4D 96.483 2218 62 4 119 2321 496006351 496008567 0 3650
16 TraesCS4A01G156400 chr1B 94.108 2342 112 12 1 2319 122762308 122764646 0 3537


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G156400 chr4A 311668693 311671013 2320 True 4287 4287 100.000 1 2321 1 chr4A.!!$R1 2320
1 TraesCS4A01G156400 chr4A 640974982 640975831 849 False 1369 1369 95.882 2 844 1 chr4A.!!$F1 842
2 TraesCS4A01G156400 chr7A 94443345 94445675 2330 True 3952 3952 97.340 1 2321 1 chr7A.!!$R1 2320
3 TraesCS4A01G156400 chr7A 665977683 665979969 2286 False 3819 3819 96.856 41 2321 1 chr7A.!!$F2 2280
4 TraesCS4A01G156400 chr7A 546231936 546233814 1878 False 3155 3155 97.023 1 1873 1 chr7A.!!$F1 1872
5 TraesCS4A01G156400 chr5A 30143736 30146063 2327 False 3916 3916 97.080 1 2321 1 chr5A.!!$F1 2320
6 TraesCS4A01G156400 chr5A 375868365 375869497 1132 True 1892 1892 96.911 1 1126 1 chr5A.!!$R1 1125
7 TraesCS4A01G156400 chr2D 63681697 63684031 2334 False 3868 3868 96.661 1 2321 1 chr2D.!!$F1 2320
8 TraesCS4A01G156400 chr2A 690342196 690344484 2288 False 3860 3860 97.160 41 2321 1 chr2A.!!$F1 2280
9 TraesCS4A01G156400 chr3A 740088101 740090427 2326 True 3838 3838 96.479 1 2321 1 chr3A.!!$R2 2320
10 TraesCS4A01G156400 chr3A 60825449 60827737 2288 True 3821 3821 96.855 41 2321 1 chr3A.!!$R1 2280
11 TraesCS4A01G156400 chr7D 463977644 463979919 2275 False 3759 3759 96.574 60 2321 1 chr7D.!!$F2 2261
12 TraesCS4A01G156400 chr7D 501825319 501826062 743 True 1179 1179 95.200 1 749 1 chr7D.!!$R1 748
13 TraesCS4A01G156400 chr1A 72584813 72587140 2327 False 3677 3677 95.240 1 2320 1 chr1A.!!$F1 2319
14 TraesCS4A01G156400 chr4D 496006351 496008567 2216 False 3650 3650 96.483 119 2321 1 chr4D.!!$F1 2202
15 TraesCS4A01G156400 chr1B 122762308 122764646 2338 False 3537 3537 94.108 1 2319 1 chr1B.!!$F1 2318

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
627 644 1.063567 AGGTTGCAGGTTTGGTTGGTA 60.064 47.619 0.0 0.0 0.0 3.25 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1490 1511 0.968901 TCTCAACATACTCCGGCGGT 60.969 55.0 27.32 10.46 0.0 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 3.559655 GGTTGAAAAGAATTGGTGTTGGC 59.440 43.478 0.00 0.00 0.00 4.52
607 624 1.228124 CTGAGGGGTGGCGACAAAA 60.228 57.895 0.00 0.00 46.06 2.44
627 644 1.063567 AGGTTGCAGGTTTGGTTGGTA 60.064 47.619 0.00 0.00 0.00 3.25
664 681 5.473039 GTGGATTCATGAAACAAAGAAGGG 58.527 41.667 13.09 0.00 0.00 3.95
686 703 2.026262 TCCTAGGCCATCTGGTGTTTTC 60.026 50.000 5.01 0.00 37.57 2.29
1071 1088 2.799126 TTTGGATGTGGGAGCGTATT 57.201 45.000 0.00 0.00 0.00 1.89
1282 1299 5.210430 TCAAATCCCTTGCCATCATTACAT 58.790 37.500 0.00 0.00 34.76 2.29
1490 1511 2.025589 TTGGAGTACAACAACGCACA 57.974 45.000 0.00 0.00 33.18 4.57
1567 1588 9.625747 TGTACCATATGTTGATCAATGTGTAAT 57.374 29.630 12.12 2.35 0.00 1.89
1572 1593 6.741992 ATGTTGATCAATGTGTAATCACGT 57.258 33.333 12.12 0.00 46.49 4.49
1815 1837 1.079819 CTTGGACTCGTGCCGATGT 60.080 57.895 0.00 0.00 34.61 3.06
1995 2017 6.719370 TGTCACTTAAGTTTTATTCAGGGCAT 59.281 34.615 5.07 0.00 0.00 4.40
2230 2267 1.449423 CATGGCGGTTCATCCACGA 60.449 57.895 0.00 0.00 34.81 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 6.094739 AGATACAAATCACGAACGACATTG 57.905 37.500 0.14 3.82 34.28 2.82
481 498 1.949525 GAGCAAGGTGAAAAGAGTGCA 59.050 47.619 0.00 0.00 34.44 4.57
607 624 0.325203 ACCAACCAAACCTGCAACCT 60.325 50.000 0.00 0.00 0.00 3.50
627 644 1.540367 TCCACGGGGGAGGTTCAAT 60.540 57.895 2.42 0.00 42.15 2.57
664 681 0.912486 AACACCAGATGGCCTAGGAC 59.088 55.000 14.75 11.51 39.32 3.85
686 703 6.506500 AAATGTTCTTGTAGCCATGAGAAG 57.493 37.500 0.00 0.00 0.00 2.85
741 758 0.537188 CTGGCGTACCTCTCCACAAT 59.463 55.000 0.00 0.00 36.63 2.71
1071 1088 1.122632 TGAAGTTACGGCCCACAGGA 61.123 55.000 0.00 0.00 33.47 3.86
1490 1511 0.968901 TCTCAACATACTCCGGCGGT 60.969 55.000 27.32 10.46 0.00 5.68
1567 1588 5.570973 CGGCATCATTTTCATTTTTACGTGA 59.429 36.000 0.00 0.00 0.00 4.35
1572 1593 9.515020 GAAGTATCGGCATCATTTTCATTTTTA 57.485 29.630 0.00 0.00 0.00 1.52
1815 1837 3.826157 CCTCACTTGGCATTACTTCCAAA 59.174 43.478 0.00 0.00 41.35 3.28
1995 2017 5.781818 TCATTGATACATCTCCATAGCTCCA 59.218 40.000 0.00 0.00 0.00 3.86
2230 2267 3.240606 GAGCACGTGCACGCACATT 62.241 57.895 39.21 18.62 46.47 2.71
2251 2288 5.007039 CGGAAGACAACACATCCATTCTATG 59.993 44.000 0.00 0.00 32.08 2.23


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.