Multiple sequence alignment - TraesCS4A01G153200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G153200 chr4A 100.000 2111 0 0 1 2111 309507404 309505294 0 3899
1 TraesCS4A01G153200 chr5D 95.374 2140 68 14 1 2110 503287030 503289168 0 3374
2 TraesCS4A01G153200 chr5D 94.855 2138 69 18 1 2111 6181216 6179093 0 3301
3 TraesCS4A01G153200 chr5D 94.085 2130 92 19 1 2110 167071664 167073779 0 3205
4 TraesCS4A01G153200 chr5D 95.561 1532 41 11 520 2026 512409297 512407768 0 2427
5 TraesCS4A01G153200 chr5D 95.511 1448 37 10 520 1940 512416234 512414788 0 2289
6 TraesCS4A01G153200 chr1D 95.399 2130 76 10 1 2110 51878343 51876216 0 3371
7 TraesCS4A01G153200 chr1D 95.265 2133 64 14 1 2110 254416795 254418913 0 3345
8 TraesCS4A01G153200 chr6D 95.318 2136 64 17 1 2110 45511841 45509716 0 3358
9 TraesCS4A01G153200 chr1A 94.587 2143 68 26 1 2110 554458197 554460324 0 3271
10 TraesCS4A01G153200 chr1A 94.723 777 27 9 1 763 554455935 554456711 0 1195
11 TraesCS4A01G153200 chr5A 94.131 2130 86 15 1 2110 607200360 607198250 0 3205
12 TraesCS4A01G153200 chr2B 94.582 2067 73 15 66 2110 474900137 474902186 0 3160
13 TraesCS4A01G153200 chr2D 95.165 1965 58 15 171 2110 9785044 9786996 0 3068
14 TraesCS4A01G153200 chr2A 94.717 1060 38 11 1 1045 335830897 335829841 0 1631
15 TraesCS4A01G153200 chr3B 94.403 804 31 9 1 790 101919315 101918512 0 1223


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G153200 chr4A 309505294 309507404 2110 True 3899 3899 100.000 1 2111 1 chr4A.!!$R1 2110
1 TraesCS4A01G153200 chr5D 503287030 503289168 2138 False 3374 3374 95.374 1 2110 1 chr5D.!!$F2 2109
2 TraesCS4A01G153200 chr5D 6179093 6181216 2123 True 3301 3301 94.855 1 2111 1 chr5D.!!$R1 2110
3 TraesCS4A01G153200 chr5D 167071664 167073779 2115 False 3205 3205 94.085 1 2110 1 chr5D.!!$F1 2109
4 TraesCS4A01G153200 chr5D 512407768 512409297 1529 True 2427 2427 95.561 520 2026 1 chr5D.!!$R2 1506
5 TraesCS4A01G153200 chr5D 512414788 512416234 1446 True 2289 2289 95.511 520 1940 1 chr5D.!!$R3 1420
6 TraesCS4A01G153200 chr1D 51876216 51878343 2127 True 3371 3371 95.399 1 2110 1 chr1D.!!$R1 2109
7 TraesCS4A01G153200 chr1D 254416795 254418913 2118 False 3345 3345 95.265 1 2110 1 chr1D.!!$F1 2109
8 TraesCS4A01G153200 chr6D 45509716 45511841 2125 True 3358 3358 95.318 1 2110 1 chr6D.!!$R1 2109
9 TraesCS4A01G153200 chr1A 554455935 554460324 4389 False 2233 3271 94.655 1 2110 2 chr1A.!!$F1 2109
10 TraesCS4A01G153200 chr5A 607198250 607200360 2110 True 3205 3205 94.131 1 2110 1 chr5A.!!$R1 2109
11 TraesCS4A01G153200 chr2B 474900137 474902186 2049 False 3160 3160 94.582 66 2110 1 chr2B.!!$F1 2044
12 TraesCS4A01G153200 chr2D 9785044 9786996 1952 False 3068 3068 95.165 171 2110 1 chr2D.!!$F1 1939
13 TraesCS4A01G153200 chr2A 335829841 335830897 1056 True 1631 1631 94.717 1 1045 1 chr2A.!!$R1 1044
14 TraesCS4A01G153200 chr3B 101918512 101919315 803 True 1223 1223 94.403 1 790 1 chr3B.!!$R1 789

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
302 2567 5.348724 TCTCATTTGAGAGTGCGAATACAAC 59.651 40.0 6.17 0.0 45.48 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1199 3510 1.284785 TCCGCTCCCTTGGATCATTTT 59.715 47.619 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
241 2506 9.621629 AAATGCATTGATCATTACATGGAATTT 57.378 25.926 13.82 0.00 34.09 1.82
302 2567 5.348724 TCTCATTTGAGAGTGCGAATACAAC 59.651 40.000 6.17 0.00 45.48 3.32
327 2592 6.016943 CGAGGTATTTTGTGTTTGGGAAAGTA 60.017 38.462 0.00 0.00 0.00 2.24
623 2902 9.539825 CATGAAATCTTTAGTACTCTGTATGCT 57.460 33.333 0.00 0.00 0.00 3.79
766 3050 6.064846 AGCTACAGCAATAAATTTGGATCG 57.935 37.500 0.00 0.00 45.16 3.69
1185 3496 1.282157 CCGGGGGTCAGAATTCTTTCT 59.718 52.381 4.86 0.00 43.09 2.52
1191 3502 6.187682 GGGGGTCAGAATTCTTTCTAATTCA 58.812 40.000 4.86 0.00 44.70 2.57
1221 3532 1.143813 ATGATCCAAGGGAGCGGAAT 58.856 50.000 0.00 0.00 41.58 3.01
1305 3618 0.900421 CACTCAGCCATCTCTCCACA 59.100 55.000 0.00 0.00 0.00 4.17
1313 3626 2.424956 GCCATCTCTCCACATTCCAAAC 59.575 50.000 0.00 0.00 0.00 2.93
1643 3967 7.301868 AGCAAAAAGGGTTCTTATCAAATCA 57.698 32.000 0.00 0.00 32.01 2.57
1809 4137 7.241376 AGACAAGAATTTTTCGCTATTTACGG 58.759 34.615 0.00 0.00 34.02 4.02
1905 4236 5.385509 TGGATTTCGAAGGTCCATTTTTC 57.614 39.130 22.98 4.07 37.12 2.29
1910 4243 6.709018 TTTCGAAGGTCCATTTTTCTTTCT 57.291 33.333 0.00 0.00 0.00 2.52
1944 4280 1.620822 AGTTCTTCCACCCATGCAAC 58.379 50.000 0.00 0.00 0.00 4.17
1946 4282 1.000274 GTTCTTCCACCCATGCAACAC 60.000 52.381 0.00 0.00 0.00 3.32
2038 4374 6.894103 AGGAGTCTTGGAATAATGCTGAATTT 59.106 34.615 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 1.828595 TCGGATGTTCGAATCCTTCCA 59.171 47.619 14.33 1.72 43.53 3.53
258 2523 9.525826 AATGAGAGTGGAATAAATTTGACTTCT 57.474 29.630 0.00 0.00 0.00 2.85
302 2567 4.839668 TTCCCAAACACAAAATACCTCG 57.160 40.909 0.00 0.00 0.00 4.63
597 2876 9.539825 AGCATACAGAGTACTAAAGATTTCATG 57.460 33.333 0.00 0.00 0.00 3.07
725 3009 3.700538 AGCTACCCATTCAATGCAGAAA 58.299 40.909 0.00 0.00 0.00 2.52
730 3014 2.291741 GCTGTAGCTACCCATTCAATGC 59.708 50.000 21.01 7.56 38.21 3.56
766 3050 1.224870 GCAGGGGAGTAGAAAGGCC 59.775 63.158 0.00 0.00 0.00 5.19
929 3229 1.330655 ACACGGATCCACTAGGCTGG 61.331 60.000 13.41 0.00 33.74 4.85
930 3230 0.179100 CACACGGATCCACTAGGCTG 60.179 60.000 13.41 0.00 33.74 4.85
932 3232 1.144057 CCACACGGATCCACTAGGC 59.856 63.158 13.41 0.00 33.74 3.93
1059 3366 7.946776 CCTGGGTCATTAGATAAGAATCCAAAT 59.053 37.037 0.00 0.00 31.98 2.32
1151 3462 3.120108 ACCCCCGGATTTTCTCATAGAA 58.880 45.455 0.73 0.00 31.28 2.10
1185 3496 9.709495 CTTGGATCATTTTGGACTTTTGAATTA 57.291 29.630 0.00 0.00 0.00 1.40
1191 3502 5.154418 TCCCTTGGATCATTTTGGACTTTT 58.846 37.500 0.00 0.00 0.00 2.27
1199 3510 1.284785 TCCGCTCCCTTGGATCATTTT 59.715 47.619 0.00 0.00 0.00 1.82
1856 4184 4.530710 ATGTGTAGCGTAAAGGAGTTGA 57.469 40.909 0.00 0.00 0.00 3.18
1867 4195 6.092944 TCGAAATCCAATTTTATGTGTAGCGT 59.907 34.615 0.00 0.00 31.47 5.07
1910 4243 8.871125 GGTGGAAGAACTAATATAGAGGATTCA 58.129 37.037 0.00 0.00 0.00 2.57
1922 4258 3.737559 TGCATGGGTGGAAGAACTAAT 57.262 42.857 0.00 0.00 0.00 1.73
1944 4280 3.439857 TCTTTTCCCATTCCCTCTGTG 57.560 47.619 0.00 0.00 0.00 3.66
1946 4282 3.359950 CCTTCTTTTCCCATTCCCTCTG 58.640 50.000 0.00 0.00 0.00 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.