Multiple sequence alignment - TraesCS4A01G152200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G152200 chr4A 100.000 2432 0 0 1 2432 309374004 309376435 0.000000e+00 4492.0
1 TraesCS4A01G152200 chr4A 95.087 692 33 1 1 691 115845315 115844624 0.000000e+00 1088.0
2 TraesCS4A01G152200 chr4A 95.322 684 31 1 1 684 97810856 97810174 0.000000e+00 1085.0
3 TraesCS4A01G152200 chr5D 97.558 1761 38 4 677 2432 503330624 503328864 0.000000e+00 3009.0
4 TraesCS4A01G152200 chr5D 96.989 1760 49 3 677 2432 6236187 6237946 0.000000e+00 2953.0
5 TraesCS4A01G152200 chr1D 96.934 1761 48 5 677 2432 254476711 254474952 0.000000e+00 2948.0
6 TraesCS4A01G152200 chr1D 96.252 1761 60 5 677 2432 180356681 180358440 0.000000e+00 2881.0
7 TraesCS4A01G152200 chr1D 95.346 1762 67 8 677 2432 244768194 244766442 0.000000e+00 2785.0
8 TraesCS4A01G152200 chr1D 95.000 1760 81 5 677 2432 244201005 244199249 0.000000e+00 2756.0
9 TraesCS4A01G152200 chr2D 97.519 1693 35 5 677 2363 33929993 33931684 0.000000e+00 2887.0
10 TraesCS4A01G152200 chr3B 97.460 1693 36 5 677 2363 201492717 201491026 0.000000e+00 2881.0
11 TraesCS4A01G152200 chr3B 94.118 68 4 0 2365 2432 405424839 405424906 1.190000e-18 104.0
12 TraesCS4A01G152200 chr3B 96.226 53 2 0 2380 2432 729906882 729906934 1.200000e-13 87.9
13 TraesCS4A01G152200 chr1A 97.340 1692 38 6 677 2363 554448232 554449921 0.000000e+00 2868.0
14 TraesCS4A01G152200 chr1A 95.562 676 30 0 1 676 315549918 315549243 0.000000e+00 1083.0
15 TraesCS4A01G152200 chr6A 95.994 674 27 0 1 674 478821727 478822400 0.000000e+00 1096.0
16 TraesCS4A01G152200 chr5A 95.858 676 28 0 1 676 594300483 594299808 0.000000e+00 1094.0
17 TraesCS4A01G152200 chr5A 95.308 682 32 0 1 682 578257485 578258166 0.000000e+00 1083.0
18 TraesCS4A01G152200 chr7A 95.710 676 29 0 1 676 244679498 244678823 0.000000e+00 1088.0
19 TraesCS4A01G152200 chr7A 95.301 681 31 1 1 681 502736767 502737446 0.000000e+00 1079.0
20 TraesCS4A01G152200 chr3A 95.562 676 30 0 1 676 305823897 305824572 0.000000e+00 1083.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G152200 chr4A 309374004 309376435 2431 False 4492 4492 100.000 1 2432 1 chr4A.!!$F1 2431
1 TraesCS4A01G152200 chr4A 115844624 115845315 691 True 1088 1088 95.087 1 691 1 chr4A.!!$R2 690
2 TraesCS4A01G152200 chr4A 97810174 97810856 682 True 1085 1085 95.322 1 684 1 chr4A.!!$R1 683
3 TraesCS4A01G152200 chr5D 503328864 503330624 1760 True 3009 3009 97.558 677 2432 1 chr5D.!!$R1 1755
4 TraesCS4A01G152200 chr5D 6236187 6237946 1759 False 2953 2953 96.989 677 2432 1 chr5D.!!$F1 1755
5 TraesCS4A01G152200 chr1D 254474952 254476711 1759 True 2948 2948 96.934 677 2432 1 chr1D.!!$R3 1755
6 TraesCS4A01G152200 chr1D 180356681 180358440 1759 False 2881 2881 96.252 677 2432 1 chr1D.!!$F1 1755
7 TraesCS4A01G152200 chr1D 244766442 244768194 1752 True 2785 2785 95.346 677 2432 1 chr1D.!!$R2 1755
8 TraesCS4A01G152200 chr1D 244199249 244201005 1756 True 2756 2756 95.000 677 2432 1 chr1D.!!$R1 1755
9 TraesCS4A01G152200 chr2D 33929993 33931684 1691 False 2887 2887 97.519 677 2363 1 chr2D.!!$F1 1686
10 TraesCS4A01G152200 chr3B 201491026 201492717 1691 True 2881 2881 97.460 677 2363 1 chr3B.!!$R1 1686
11 TraesCS4A01G152200 chr1A 554448232 554449921 1689 False 2868 2868 97.340 677 2363 1 chr1A.!!$F1 1686
12 TraesCS4A01G152200 chr1A 315549243 315549918 675 True 1083 1083 95.562 1 676 1 chr1A.!!$R1 675
13 TraesCS4A01G152200 chr6A 478821727 478822400 673 False 1096 1096 95.994 1 674 1 chr6A.!!$F1 673
14 TraesCS4A01G152200 chr5A 594299808 594300483 675 True 1094 1094 95.858 1 676 1 chr5A.!!$R1 675
15 TraesCS4A01G152200 chr5A 578257485 578258166 681 False 1083 1083 95.308 1 682 1 chr5A.!!$F1 681
16 TraesCS4A01G152200 chr7A 244678823 244679498 675 True 1088 1088 95.710 1 676 1 chr7A.!!$R1 675
17 TraesCS4A01G152200 chr7A 502736767 502737446 679 False 1079 1079 95.301 1 681 1 chr7A.!!$F1 680
18 TraesCS4A01G152200 chr3A 305823897 305824572 675 False 1083 1083 95.562 1 676 1 chr3A.!!$F1 675

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
241 242 0.327191 GATCTTGGGTAGGGGGTCCA 60.327 60.0 0.0 0.0 34.83 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1463 1468 1.620323 AGTTTGAAAGATTGCCCTGCC 59.38 47.619 0.0 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
217 218 2.650322 ACCAATGTCGGTGTCAAAACT 58.350 42.857 0.00 0.00 38.07 2.66
227 228 1.880027 GTGTCAAAACTGGCGGATCTT 59.120 47.619 0.00 0.00 0.00 2.40
241 242 0.327191 GATCTTGGGTAGGGGGTCCA 60.327 60.000 0.00 0.00 34.83 4.02
259 260 1.000955 CCAGAACTGTGCGTCTAAGGT 59.999 52.381 1.18 0.00 0.00 3.50
613 614 9.809096 GTCTTCAATCTTGTATCTTCATAGTCA 57.191 33.333 0.00 0.00 0.00 3.41
834 838 6.368791 TCAACTACACCAAATGATCTTTCGAG 59.631 38.462 0.00 0.00 0.00 4.04
871 875 5.520748 CCAGTTTATGGCCCCTTCTATAT 57.479 43.478 0.00 0.00 43.83 0.86
885 889 6.353602 CCCCTTCTATATGGTACCAGTTGTTT 60.354 42.308 21.41 4.59 0.00 2.83
886 890 7.147444 CCCCTTCTATATGGTACCAGTTGTTTA 60.147 40.741 21.41 6.93 0.00 2.01
932 936 2.673368 GGCTCACGATTCGACTTTGATT 59.327 45.455 13.95 0.00 0.00 2.57
970 975 4.323792 CCAAGATCAAGTCCTAGGAAGCAA 60.324 45.833 14.65 0.00 0.00 3.91
1032 1037 7.019388 TGGCTCCCTCTTTAGTGAGATTATAT 58.981 38.462 0.00 0.00 36.23 0.86
1463 1468 8.978539 GGGCTCTTTTGTGTAGAAAAATAAAAG 58.021 33.333 0.00 0.00 36.80 2.27
1551 1556 3.023119 CAATGCAGCAGGGTTGGTTATA 58.977 45.455 0.00 0.00 31.36 0.98
1594 1599 4.111577 AGGTGGTTCATAGATCTTTGGGA 58.888 43.478 12.51 0.73 0.00 4.37
1831 1839 5.172205 GGATAATCCTAGAATTCCGTCTGC 58.828 45.833 0.65 0.00 32.53 4.26
1878 1886 6.682863 CGATTTTCAAGAACGCGAATCTTATT 59.317 34.615 23.96 6.44 35.43 1.40
1921 1929 1.745232 AATCATCCGCGCCTTAAACA 58.255 45.000 0.00 0.00 0.00 2.83
1954 1962 1.635487 TGAAAGTTGGATAGGCTGGCT 59.365 47.619 9.28 9.28 0.00 4.75
1959 1967 3.321950 AGTTGGATAGGCTGGCTCTTAT 58.678 45.455 7.13 0.00 0.00 1.73
1986 1994 7.432148 AAGGATTACATAACCCCCAATTTTC 57.568 36.000 0.00 0.00 0.00 2.29
2104 2113 6.985188 TCTTTTCCTAGATGAAACGGAATG 57.015 37.500 0.00 0.00 35.63 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
217 218 2.070039 CCCTACCCAAGATCCGCCA 61.070 63.158 0.00 0.00 0.00 5.69
227 228 1.229723 GTTCTGGACCCCCTACCCA 60.230 63.158 0.00 0.00 0.00 4.51
241 242 1.000955 CCACCTTAGACGCACAGTTCT 59.999 52.381 0.00 0.00 0.00 3.01
259 260 2.711009 CCCTGCCTCTTATTACCATCCA 59.289 50.000 0.00 0.00 0.00 3.41
377 378 4.316645 CCTCTTCGATCTCGTGGTAGATA 58.683 47.826 0.00 0.00 36.33 1.98
613 614 8.101419 GGATTATATCCTTTGGTCGGACTATTT 58.899 37.037 8.23 0.00 46.19 1.40
834 838 3.477210 AACTGGAGAGTCTTGACCAAC 57.523 47.619 0.00 0.00 31.85 3.77
871 875 7.825331 TTCAATGAATAAACAACTGGTACCA 57.175 32.000 15.39 15.39 0.00 3.25
932 936 6.320434 TGATCTTGGTACCAATCCATAACA 57.680 37.500 27.24 16.27 35.20 2.41
970 975 4.392754 CGTACCGGCTGTTAAAATTAGGTT 59.607 41.667 0.00 0.00 32.47 3.50
996 1001 4.591321 AGAGGGAGCCATTTTCATTGTA 57.409 40.909 0.00 0.00 0.00 2.41
1032 1037 1.702182 TTGGTTCAGGCATTTGCTCA 58.298 45.000 2.12 0.00 41.70 4.26
1099 1104 7.308469 CCGAACAGTACTATAGGAATCTGTACC 60.308 44.444 8.31 4.25 35.53 3.34
1463 1468 1.620323 AGTTTGAAAGATTGCCCTGCC 59.380 47.619 0.00 0.00 0.00 4.85
1551 1556 6.319658 CACCTCATGTTTGACTAGCCAATTAT 59.680 38.462 0.00 0.00 0.00 1.28
1594 1599 5.600484 AGTCTCTATTCCTCGGTGATCAAAT 59.400 40.000 0.00 0.00 0.00 2.32
1831 1839 2.751806 GCACTTCTCCAAATCCAGAAGG 59.248 50.000 12.18 4.09 46.86 3.46
1921 1929 6.266131 TCCAACTTTCAGGCATTAGGATAT 57.734 37.500 0.00 0.00 0.00 1.63
1970 1978 7.846066 TGTATTTCAGAAAATTGGGGGTTATG 58.154 34.615 0.00 0.00 36.49 1.90
1986 1994 8.403236 TCATTCAATGAGCATCTTGTATTTCAG 58.597 33.333 0.00 0.00 33.59 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.