Multiple sequence alignment - TraesCS4A01G145100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G145100 chr4A 100.000 2246 0 0 1 2246 246673733 246671488 0 4148
1 TraesCS4A01G145100 chr6D 98.178 2250 34 6 1 2246 124501730 124503976 0 3921
2 TraesCS4A01G145100 chrUn 97.956 2250 35 3 1 2246 206782860 206785102 0 3890
3 TraesCS4A01G145100 chr4D 97.956 2250 35 3 1 2246 123319685 123321927 0 3890
4 TraesCS4A01G145100 chr7A 97.687 2248 43 3 1 2246 60263515 60265755 0 3855
5 TraesCS4A01G145100 chr7A 97.241 2247 58 3 1 2246 46421127 46423370 0 3803
6 TraesCS4A01G145100 chr5A 97.553 2248 50 5 1 2246 238848354 238846110 0 3842
7 TraesCS4A01G145100 chr1B 97.552 2247 42 4 1 2246 672569887 672567653 0 3832
8 TraesCS4A01G145100 chr3B 97.375 2248 54 2 1 2246 483384915 483387159 0 3819
9 TraesCS4A01G145100 chr3B 97.198 2248 59 3 1 2246 669796317 669794072 0 3799


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G145100 chr4A 246671488 246673733 2245 True 4148 4148 100.000 1 2246 1 chr4A.!!$R1 2245
1 TraesCS4A01G145100 chr6D 124501730 124503976 2246 False 3921 3921 98.178 1 2246 1 chr6D.!!$F1 2245
2 TraesCS4A01G145100 chrUn 206782860 206785102 2242 False 3890 3890 97.956 1 2246 1 chrUn.!!$F1 2245
3 TraesCS4A01G145100 chr4D 123319685 123321927 2242 False 3890 3890 97.956 1 2246 1 chr4D.!!$F1 2245
4 TraesCS4A01G145100 chr7A 60263515 60265755 2240 False 3855 3855 97.687 1 2246 1 chr7A.!!$F2 2245
5 TraesCS4A01G145100 chr7A 46421127 46423370 2243 False 3803 3803 97.241 1 2246 1 chr7A.!!$F1 2245
6 TraesCS4A01G145100 chr5A 238846110 238848354 2244 True 3842 3842 97.553 1 2246 1 chr5A.!!$R1 2245
7 TraesCS4A01G145100 chr1B 672567653 672569887 2234 True 3832 3832 97.552 1 2246 1 chr1B.!!$R1 2245
8 TraesCS4A01G145100 chr3B 483384915 483387159 2244 False 3819 3819 97.375 1 2246 1 chr3B.!!$F1 2245
9 TraesCS4A01G145100 chr3B 669794072 669796317 2245 True 3799 3799 97.198 1 2246 1 chr3B.!!$R1 2245

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
719 725 0.756903 CGATTCCACCGGGGTCTTAT 59.243 55.0 6.32 0.0 38.11 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1707 1713 9.683069 GTCAATGTCAATCAAGTAAGAAAATGT 57.317 29.63 0.0 0.0 0.0 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 1.404843 GCTTCTACTCCTCCACCGAT 58.595 55.000 0.00 0.00 0.00 4.18
433 439 0.757935 TTTAGATCTACGGGCCGGCT 60.758 55.000 31.78 19.65 0.00 5.52
462 468 8.116026 TCACATGAGCATAGGGAATCTATACTA 58.884 37.037 0.00 0.00 36.59 1.82
464 470 7.563188 ACATGAGCATAGGGAATCTATACTAGG 59.437 40.741 0.00 0.00 36.59 3.02
467 473 5.042979 AGCATAGGGAATCTATACTAGGGCT 60.043 44.000 0.00 0.00 36.59 5.19
527 533 6.267242 CACTCTTGAGATCTGATCTATTGGGA 59.733 42.308 19.57 12.17 40.38 4.37
547 553 2.623416 GACCTACAACTTTGCCAAAGCT 59.377 45.455 16.89 1.78 42.27 3.74
696 702 3.302161 TCTTGCCTATTAGTAAGCGGGA 58.698 45.455 3.28 0.00 0.00 5.14
719 725 0.756903 CGATTCCACCGGGGTCTTAT 59.243 55.000 6.32 0.00 38.11 1.73
754 760 5.350504 GGGGGAGAACTACCTAACTAAAC 57.649 47.826 2.93 0.00 32.79 2.01
859 865 1.653151 GTCGACCCAACCTTATGAGC 58.347 55.000 3.51 0.00 0.00 4.26
880 886 4.161565 AGCATTCGGACTATAACAGTTCCA 59.838 41.667 0.00 0.00 37.72 3.53
1067 1073 3.072915 TCCTCAGGTGTCAAATGTGATGT 59.927 43.478 0.00 0.00 35.80 3.06
1249 1255 4.741928 ATCCTCCAAACCAACTAAACCT 57.258 40.909 0.00 0.00 0.00 3.50
1300 1306 1.307430 GAGGGAAGGGGGAAGCTCT 60.307 63.158 0.00 0.00 0.00 4.09
1303 1309 0.326713 GGGAAGGGGGAAGCTCTAGT 60.327 60.000 0.00 0.00 0.00 2.57
1325 1331 2.948648 CTTCGCTCGCTCGCTCAG 60.949 66.667 0.00 0.00 0.00 3.35
1371 1377 4.412199 AGTGGAGTGCATAAGCCCTTATTA 59.588 41.667 0.00 0.00 41.13 0.98
1463 1469 3.734293 GCTTCATCATCTTGCTTGCTTCC 60.734 47.826 0.00 0.00 0.00 3.46
1707 1713 4.019321 CCTTTTCCTCAGACAGTGGGAATA 60.019 45.833 0.00 0.00 36.17 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 303 0.707616 CAGGTCCCACCCCCAATTTA 59.292 55.000 0.00 0.00 39.75 1.40
433 439 3.998913 TTCCCTATGCTCATGTGAACA 57.001 42.857 0.00 0.00 0.00 3.18
462 468 2.034221 GGCCAAGTCGAAAGCCCT 59.966 61.111 0.00 0.00 39.60 5.19
464 470 3.062466 GGGGCCAAGTCGAAAGCC 61.062 66.667 4.39 7.53 44.99 4.35
467 473 2.434331 CCAGGGGCCAAGTCGAAA 59.566 61.111 4.39 0.00 0.00 3.46
527 533 2.362077 CAGCTTTGGCAAAGTTGTAGGT 59.638 45.455 34.75 17.94 42.54 3.08
547 553 2.173356 CCATGGAAAGGGATGCTAGTCA 59.827 50.000 5.56 0.00 0.00 3.41
696 702 1.896122 GACCCCGGTGGAATCGAAGT 61.896 60.000 15.08 0.00 38.00 3.01
859 865 6.761242 TCATTGGAACTGTTATAGTCCGAATG 59.239 38.462 0.00 0.00 39.18 2.67
880 886 5.647658 TGTCAAAAGTGAGTGACTGTTCATT 59.352 36.000 0.00 0.00 43.73 2.57
982 988 7.103641 ACAATCATACGTAGATGAGTTTTGGT 58.896 34.615 13.63 2.62 39.18 3.67
1067 1073 4.345859 AGATTTGAACGACCAGGTACAA 57.654 40.909 0.00 0.00 0.00 2.41
1249 1255 0.038166 ATTTCCGCTTCAGCTTCCCA 59.962 50.000 0.00 0.00 39.32 4.37
1371 1377 2.917205 AGTAAGGCCTCACCCTACTTT 58.083 47.619 5.23 0.00 40.58 2.66
1463 1469 1.705256 TAGTGTGTTAAGCTTCGCCG 58.295 50.000 0.00 0.00 0.00 6.46
1477 1483 5.868454 TCATGCATGCCTATGTTATAGTGT 58.132 37.500 22.25 0.00 36.65 3.55
1707 1713 9.683069 GTCAATGTCAATCAAGTAAGAAAATGT 57.317 29.630 0.00 0.00 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.