Multiple sequence alignment - TraesCS4A01G144700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G144700 chr4A 100.000 2231 0 0 1 2231 246656953 246654723 0.000000e+00 4120
1 TraesCS4A01G144700 chr7D 98.600 2072 28 1 1 2071 382051752 382053823 0.000000e+00 3664
2 TraesCS4A01G144700 chr7D 98.504 2072 30 1 1 2071 203501672 203503743 0.000000e+00 3653
3 TraesCS4A01G144700 chr7D 98.359 2072 33 1 1 2071 381925674 381927745 0.000000e+00 3637
4 TraesCS4A01G144700 chr7D 98.219 2078 30 3 1 2071 381972097 381970020 0.000000e+00 3626
5 TraesCS4A01G144700 chr6D 98.312 2074 32 3 1 2071 124519195 124521268 0.000000e+00 3633
6 TraesCS4A01G144700 chr7A 98.119 2073 32 3 1 2071 60280986 60283053 0.000000e+00 3605
7 TraesCS4A01G144700 chr7A 97.576 165 3 1 2068 2231 60283107 60283271 4.690000e-72 281
8 TraesCS4A01G144700 chrUn 98.023 2074 33 3 1 2071 186206748 186204680 0.000000e+00 3596
9 TraesCS4A01G144700 chrUn 98.182 165 2 1 2068 2231 186204626 186204462 1.010000e-73 287
10 TraesCS4A01G144700 chr7B 98.023 2074 33 3 1 2071 716877108 716875040 0.000000e+00 3596
11 TraesCS4A01G144700 chr7B 98.023 2074 33 4 1 2071 742991118 742993186 0.000000e+00 3596
12 TraesCS4A01G144700 chr7B 97.576 165 3 1 2068 2231 716834771 716834607 4.690000e-72 281
13 TraesCS4A01G144700 chr7B 97.576 165 3 1 2068 2231 742993240 742993404 4.690000e-72 281
14 TraesCS4A01G144700 chr7B 96.970 165 4 1 2068 2231 716874986 716874822 2.180000e-70 276
15 TraesCS4A01G144700 chr5A 97.576 165 3 1 2068 2231 238819010 238818846 4.690000e-72 281
16 TraesCS4A01G144700 chr5A 97.576 165 3 1 2068 2231 492859522 492859686 4.690000e-72 281
17 TraesCS4A01G144700 chr2B 97.576 165 3 1 2068 2231 391164803 391164967 4.690000e-72 281
18 TraesCS4A01G144700 chr4D 96.970 165 4 1 2068 2231 123536970 123537134 2.180000e-70 276


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G144700 chr4A 246654723 246656953 2230 True 4120.0 4120 100.0000 1 2231 1 chr4A.!!$R1 2230
1 TraesCS4A01G144700 chr7D 382051752 382053823 2071 False 3664.0 3664 98.6000 1 2071 1 chr7D.!!$F3 2070
2 TraesCS4A01G144700 chr7D 203501672 203503743 2071 False 3653.0 3653 98.5040 1 2071 1 chr7D.!!$F1 2070
3 TraesCS4A01G144700 chr7D 381925674 381927745 2071 False 3637.0 3637 98.3590 1 2071 1 chr7D.!!$F2 2070
4 TraesCS4A01G144700 chr7D 381970020 381972097 2077 True 3626.0 3626 98.2190 1 2071 1 chr7D.!!$R1 2070
5 TraesCS4A01G144700 chr6D 124519195 124521268 2073 False 3633.0 3633 98.3120 1 2071 1 chr6D.!!$F1 2070
6 TraesCS4A01G144700 chr7A 60280986 60283271 2285 False 1943.0 3605 97.8475 1 2231 2 chr7A.!!$F1 2230
7 TraesCS4A01G144700 chrUn 186204462 186206748 2286 True 1941.5 3596 98.1025 1 2231 2 chrUn.!!$R1 2230
8 TraesCS4A01G144700 chr7B 742991118 742993404 2286 False 1938.5 3596 97.7995 1 2231 2 chr7B.!!$F1 2230
9 TraesCS4A01G144700 chr7B 716874822 716877108 2286 True 1936.0 3596 97.4965 1 2231 2 chr7B.!!$R2 2230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
758 766 0.190069 ACCCCTGTACAGTGTCTGGA 59.81 55.0 21.18 0.0 35.51 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2041 2052 0.035056 CCAAACAGCGGGGATCTCTT 60.035 55.0 0.0 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 4.480115 TCCATATCCTTGTACGAGTCCAT 58.520 43.478 9.32 1.33 0.00 3.41
277 278 5.720371 TGTGATACAACCCTTTCCATTTG 57.280 39.130 0.00 0.00 0.00 2.32
394 395 3.748298 GCACGGAGAAATAAAGAAGTGC 58.252 45.455 1.51 1.51 45.03 4.40
646 654 0.395448 GCAGAGGGTCCGTAGTACCT 60.395 60.000 0.00 0.00 36.45 3.08
672 680 2.916355 TGGAGTGATCCAGTAGCCC 58.084 57.895 0.00 0.00 34.33 5.19
747 755 4.781087 ACATTTACAGAGCTTACCCCTGTA 59.219 41.667 7.86 7.86 41.01 2.74
758 766 0.190069 ACCCCTGTACAGTGTCTGGA 59.810 55.000 21.18 0.00 35.51 3.86
1084 1092 6.453527 CGTCTCGACAAAGAAAGAATCATCTG 60.454 42.308 0.00 0.00 35.59 2.90
1090 1098 8.025445 CGACAAAGAAAGAATCATCTGGAAAAT 58.975 33.333 0.00 0.00 35.59 1.82
1179 1188 2.107204 AGAGGCAAGTGAAGTTGGTGAT 59.893 45.455 0.32 0.00 0.00 3.06
1195 1204 2.553028 GGTGATCCGTATGATGGGCAAT 60.553 50.000 0.00 0.00 32.41 3.56
1368 1377 7.201714 GGATCATGACAAGTCGTTACTACTAGT 60.202 40.741 0.00 0.00 33.75 2.57
1957 1968 1.229820 AGGCACCCCATCACTACCA 60.230 57.895 0.00 0.00 0.00 3.25
2060 2071 0.035056 AAGAGATCCCCGCTGTTTGG 60.035 55.000 0.00 0.00 0.00 3.28
2104 2172 4.679373 AGTCGTACTCGAGACCCTATTA 57.321 45.455 21.68 0.00 46.96 0.98
2170 2239 4.036734 GGACTTGTTGTTTCATTGCTCTCA 59.963 41.667 0.00 0.00 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 5.163550 CCAGGTTCATCTCGTGTAGTGATTA 60.164 44.000 0.00 0.00 31.32 1.75
137 138 2.680429 GTCGTTCCAACAACCGACA 58.320 52.632 6.20 0.00 46.53 4.35
277 278 2.254350 GCCGTTCTTTCCCAACGC 59.746 61.111 0.00 0.00 44.27 4.84
366 367 1.580059 TATTTCTCCGTGCCCCTTCT 58.420 50.000 0.00 0.00 0.00 2.85
394 395 4.521062 CTCGGCTGCTTCTCCCCG 62.521 72.222 0.00 0.00 41.97 5.73
646 654 1.351076 TGGATCACTCCAGTGCTTCA 58.649 50.000 1.49 0.00 46.95 3.02
672 680 1.522569 CACTTCTAGGCCCCTTCCG 59.477 63.158 0.00 0.00 0.00 4.30
747 755 2.550978 CAACGTTCTTCCAGACACTGT 58.449 47.619 0.00 0.00 0.00 3.55
758 766 0.106419 TTGAAGCCCCCAACGTTCTT 60.106 50.000 0.00 0.00 0.00 2.52
1084 1092 2.828661 AGGGGTTAGGAGCATTTTCC 57.171 50.000 0.00 0.00 37.52 3.13
1090 1098 1.481871 CTACGAAGGGGTTAGGAGCA 58.518 55.000 0.00 0.00 0.00 4.26
1114 1122 6.516860 GCAGGTTCGGATCACTTACTATACAT 60.517 42.308 0.00 0.00 0.00 2.29
1179 1188 4.323485 GGAGATAATTGCCCATCATACGGA 60.323 45.833 0.00 0.00 0.00 4.69
1857 1868 0.625849 ACTTCAGCCGATGGGGAAAT 59.374 50.000 0.00 0.00 38.47 2.17
2041 2052 0.035056 CCAAACAGCGGGGATCTCTT 60.035 55.000 0.00 0.00 0.00 2.85
2060 2071 3.336138 AGTACCAAAGCTTGAGTAGGC 57.664 47.619 0.00 0.00 0.00 3.93
2104 2172 4.285775 AGAAAGGAGAAGACTAAGCAGCTT 59.714 41.667 13.46 13.46 0.00 3.74
2170 2239 5.178996 GCAATCAATATCAAGATCAGAGCGT 59.821 40.000 0.00 0.00 0.00 5.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.