Multiple sequence alignment - TraesCS4A01G133300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G133300 chr4A 100.000 2366 0 0 1 2366 180271613 180269248 0.000000e+00 4370
1 TraesCS4A01G133300 chr4A 93.596 1499 91 2 868 2366 729544596 729543103 0.000000e+00 2231
2 TraesCS4A01G133300 chr4A 93.548 713 44 2 2 713 729545303 729544592 0.000000e+00 1061
3 TraesCS4A01G133300 chr7A 98.183 2366 36 2 1 2366 610463545 610461187 0.000000e+00 4124
4 TraesCS4A01G133300 chr7A 74.924 1316 300 22 990 2298 126148074 126149366 2.040000e-160 575
5 TraesCS4A01G133300 chr6A 97.298 2369 55 6 1 2366 15386863 15384501 0.000000e+00 4012
6 TraesCS4A01G133300 chr6A 74.566 1325 287 35 990 2298 137493927 137492637 3.460000e-148 534
7 TraesCS4A01G133300 chr3B 96.091 1279 48 1 1088 2366 607809354 607808078 0.000000e+00 2084
8 TraesCS4A01G133300 chr3B 95.321 1090 47 4 1 1089 607810534 607809448 0.000000e+00 1727
9 TraesCS4A01G133300 chr3B 75.284 1319 290 26 990 2298 473235215 473236507 4.350000e-167 597
10 TraesCS4A01G133300 chr3B 85.556 360 40 7 1 352 534161157 534161512 1.340000e-97 366
11 TraesCS4A01G133300 chr7D 95.878 1213 43 4 4 1216 194637423 194638628 0.000000e+00 1956
12 TraesCS4A01G133300 chr7D 97.436 1092 28 0 1275 2366 194638625 194639716 0.000000e+00 1862
13 TraesCS4A01G133300 chr3A 97.183 639 17 1 1 638 584382225 584382863 0.000000e+00 1079
14 TraesCS4A01G133300 chr5A 97.267 622 17 0 1 622 567267147 567267768 0.000000e+00 1055
15 TraesCS4A01G133300 chr4B 74.203 1318 304 25 990 2298 321541563 321542853 3.490000e-143 518


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G133300 chr4A 180269248 180271613 2365 True 4370.0 4370 100.000 1 2366 1 chr4A.!!$R1 2365
1 TraesCS4A01G133300 chr4A 729543103 729545303 2200 True 1646.0 2231 93.572 2 2366 2 chr4A.!!$R2 2364
2 TraesCS4A01G133300 chr7A 610461187 610463545 2358 True 4124.0 4124 98.183 1 2366 1 chr7A.!!$R1 2365
3 TraesCS4A01G133300 chr7A 126148074 126149366 1292 False 575.0 575 74.924 990 2298 1 chr7A.!!$F1 1308
4 TraesCS4A01G133300 chr6A 15384501 15386863 2362 True 4012.0 4012 97.298 1 2366 1 chr6A.!!$R1 2365
5 TraesCS4A01G133300 chr6A 137492637 137493927 1290 True 534.0 534 74.566 990 2298 1 chr6A.!!$R2 1308
6 TraesCS4A01G133300 chr3B 607808078 607810534 2456 True 1905.5 2084 95.706 1 2366 2 chr3B.!!$R1 2365
7 TraesCS4A01G133300 chr3B 473235215 473236507 1292 False 597.0 597 75.284 990 2298 1 chr3B.!!$F1 1308
8 TraesCS4A01G133300 chr7D 194637423 194639716 2293 False 1909.0 1956 96.657 4 2366 2 chr7D.!!$F1 2362
9 TraesCS4A01G133300 chr3A 584382225 584382863 638 False 1079.0 1079 97.183 1 638 1 chr3A.!!$F1 637
10 TraesCS4A01G133300 chr5A 567267147 567267768 621 False 1055.0 1055 97.267 1 622 1 chr5A.!!$F1 621
11 TraesCS4A01G133300 chr4B 321541563 321542853 1290 False 518.0 518 74.203 990 2298 1 chr4B.!!$F1 1308

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
521 523 0.037447 AGGGAAGAGGCTGCTTGTTC 59.963 55.0 12.37 12.37 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1933 2051 0.179062 GCATGGTGGGTTTTGTGCAA 60.179 50.0 0.0 0.0 33.09 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 7.235935 TCTATTGTTTCCTTTCTCCGAACTA 57.764 36.000 0.00 0.00 0.00 2.24
76 77 3.248888 ACTGTACTCTGGTTAGGGCTTT 58.751 45.455 0.00 0.00 0.00 3.51
150 151 5.822519 TGACTGGAATATTTTGAGGGATTCG 59.177 40.000 0.00 0.00 0.00 3.34
152 153 5.823045 ACTGGAATATTTTGAGGGATTCGTC 59.177 40.000 0.00 0.00 0.00 4.20
194 195 3.799420 GCTTCCTCGTCATACTGTGATTC 59.201 47.826 0.00 0.00 39.48 2.52
393 394 6.893583 ACCTCACTGTAAATCTGATGCTTAT 58.106 36.000 0.00 0.00 0.00 1.73
417 418 6.757897 TGCATTACCTAGATTTTCTTGTGG 57.242 37.500 0.00 0.00 0.00 4.17
418 419 6.480763 TGCATTACCTAGATTTTCTTGTGGA 58.519 36.000 0.00 0.00 0.00 4.02
419 420 7.118723 TGCATTACCTAGATTTTCTTGTGGAT 58.881 34.615 0.00 0.00 0.00 3.41
521 523 0.037447 AGGGAAGAGGCTGCTTGTTC 59.963 55.000 12.37 12.37 0.00 3.18
564 566 6.166279 TCTACAGTTTCTTGTGGATCACATC 58.834 40.000 1.37 0.00 44.16 3.06
582 584 1.669115 CTGCTGTACTGCACCGCTT 60.669 57.895 21.93 0.00 38.15 4.68
756 758 8.704849 TGGTTTCTTTCTTAATTGATTGGAGA 57.295 30.769 0.00 0.00 0.00 3.71
1333 1450 6.463049 GCTGGAAGAGATAGTGGCTACATTTA 60.463 42.308 2.02 0.00 34.07 1.40
1390 1507 9.319223 GAACAATCAAGAAGTTCTTTTATCGAC 57.681 33.333 15.60 2.98 38.79 4.20
1483 1600 3.130734 AGAAACCAGAGCCTATACCCA 57.869 47.619 0.00 0.00 0.00 4.51
1697 1815 2.795960 AGGGAGGTATAGGTCAAGGCTA 59.204 50.000 0.00 0.00 0.00 3.93
2083 2202 6.662865 TTTTCCTATCAAAACTCATTGCCA 57.337 33.333 0.00 0.00 0.00 4.92
2110 2229 1.813513 ATGGCATGCGCTCTATTACC 58.186 50.000 12.44 0.88 38.60 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 5.303589 TCTTCTAGTTCGGAGAAAGGAAACA 59.696 40.000 0.00 0.00 45.90 2.83
31 32 1.541588 GCCAAAACGCTTGGATCTTCT 59.458 47.619 18.57 0.00 42.06 2.85
76 77 9.706691 CAAATCTCAACTGGTTTACTAAGTCTA 57.293 33.333 0.00 0.00 0.00 2.59
150 151 6.617879 AGCAAAAATTACTAATTCCACCGAC 58.382 36.000 0.00 0.00 0.00 4.79
152 153 6.530181 GGAAGCAAAAATTACTAATTCCACCG 59.470 38.462 0.00 0.00 35.97 4.94
393 394 6.945435 TCCACAAGAAAATCTAGGTAATGCAA 59.055 34.615 0.00 0.00 0.00 4.08
417 418 3.712187 TCACCCTCGCAAAACAAAAATC 58.288 40.909 0.00 0.00 0.00 2.17
418 419 3.810310 TCACCCTCGCAAAACAAAAAT 57.190 38.095 0.00 0.00 0.00 1.82
419 420 3.810310 ATCACCCTCGCAAAACAAAAA 57.190 38.095 0.00 0.00 0.00 1.94
582 584 1.131638 ACTCTCACTGAGGCCACAAA 58.868 50.000 5.01 0.00 46.72 2.83
805 820 5.878406 AGCAAGCAACCTATATGAGTACT 57.122 39.130 0.00 0.00 0.00 2.73
843 863 3.056322 GGGCACAAGAATTCTGAAGCATT 60.056 43.478 20.82 0.00 0.00 3.56
845 865 1.888512 GGGCACAAGAATTCTGAAGCA 59.111 47.619 20.82 0.00 0.00 3.91
1266 1383 6.137104 TCTAGACCACCAGTAACTCTAACT 57.863 41.667 0.00 0.00 0.00 2.24
1363 1480 9.051679 TCGATAAAAGAACTTCTTGATTGTTCA 57.948 29.630 4.75 0.00 41.56 3.18
1390 1507 1.132453 TCTGCTTATCGTCTCACCACG 59.868 52.381 0.00 0.00 41.36 4.94
1621 1739 1.846007 ACCATCTAATGCGCCCAAAA 58.154 45.000 4.18 0.00 0.00 2.44
1697 1815 8.199449 CCCAAAACATTTGTATCAATATCAGCT 58.801 33.333 2.53 0.00 0.00 4.24
1933 2051 0.179062 GCATGGTGGGTTTTGTGCAA 60.179 50.000 0.00 0.00 33.09 4.08
2083 2202 3.947868 AGAGCGCATGCCATTATAATCT 58.052 40.909 13.15 0.00 44.31 2.40
2110 2229 9.037737 CAGCCATATTTTGTAAAATCAGATTGG 57.962 33.333 5.90 8.06 39.24 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.