Multiple sequence alignment - TraesCS4A01G127800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G127800 chr4A 100.000 2936 0 0 1 2936 164680322 164677387 0 5422
1 TraesCS4A01G127800 chr4A 96.372 2949 87 4 1 2936 501277496 501280437 0 4835
2 TraesCS4A01G127800 chr4A 96.068 2950 102 2 1 2936 473304674 473301725 0 4793
3 TraesCS4A01G127800 chr4A 96.033 2949 102 3 1 2936 45771439 45774385 0 4783
4 TraesCS4A01G127800 chr3A 96.610 2950 86 2 1 2936 126059345 126062294 0 4881
5 TraesCS4A01G127800 chr3A 96.338 2949 93 6 1 2936 360509716 360506770 0 4833
6 TraesCS4A01G127800 chr3A 96.305 2950 95 2 1 2936 640115516 640118465 0 4831
7 TraesCS4A01G127800 chr3A 96.488 2392 70 2 558 2936 699401489 699403879 0 3940
8 TraesCS4A01G127800 chr7A 96.441 2950 91 2 1 2936 156100200 156097251 0 4854
9 TraesCS4A01G127800 chr7A 96.373 2950 93 2 1 2936 734006012 734008961 0 4843
10 TraesCS4A01G127800 chr5A 96.406 2949 90 4 1 2936 558663945 558661000 0 4844
11 TraesCS4A01G127800 chr5A 96.339 2950 92 3 1 2936 341125644 341122697 0 4835
12 TraesCS4A01G127800 chr5A 96.236 2949 95 4 1 2936 601267787 601270732 0 4817
13 TraesCS4A01G127800 chr1A 96.406 2949 91 3 1 2936 442540182 442543128 0 4844
14 TraesCS4A01G127800 chr1A 96.104 2952 98 4 1 2936 4492375 4489425 0 4798
15 TraesCS4A01G127800 chr1A 96.134 2949 95 4 1 2936 181526826 181523884 0 4796
16 TraesCS4A01G127800 chr1A 95.630 2952 111 5 1 2936 194446659 194449608 0 4721
17 TraesCS4A01G127800 chr6A 96.134 2949 100 2 1 2936 550812407 550809460 0 4802


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G127800 chr4A 164677387 164680322 2935 True 5422 5422 100.000 1 2936 1 chr4A.!!$R1 2935
1 TraesCS4A01G127800 chr4A 501277496 501280437 2941 False 4835 4835 96.372 1 2936 1 chr4A.!!$F2 2935
2 TraesCS4A01G127800 chr4A 473301725 473304674 2949 True 4793 4793 96.068 1 2936 1 chr4A.!!$R2 2935
3 TraesCS4A01G127800 chr4A 45771439 45774385 2946 False 4783 4783 96.033 1 2936 1 chr4A.!!$F1 2935
4 TraesCS4A01G127800 chr3A 126059345 126062294 2949 False 4881 4881 96.610 1 2936 1 chr3A.!!$F1 2935
5 TraesCS4A01G127800 chr3A 360506770 360509716 2946 True 4833 4833 96.338 1 2936 1 chr3A.!!$R1 2935
6 TraesCS4A01G127800 chr3A 640115516 640118465 2949 False 4831 4831 96.305 1 2936 1 chr3A.!!$F2 2935
7 TraesCS4A01G127800 chr3A 699401489 699403879 2390 False 3940 3940 96.488 558 2936 1 chr3A.!!$F3 2378
8 TraesCS4A01G127800 chr7A 156097251 156100200 2949 True 4854 4854 96.441 1 2936 1 chr7A.!!$R1 2935
9 TraesCS4A01G127800 chr7A 734006012 734008961 2949 False 4843 4843 96.373 1 2936 1 chr7A.!!$F1 2935
10 TraesCS4A01G127800 chr5A 558661000 558663945 2945 True 4844 4844 96.406 1 2936 1 chr5A.!!$R2 2935
11 TraesCS4A01G127800 chr5A 341122697 341125644 2947 True 4835 4835 96.339 1 2936 1 chr5A.!!$R1 2935
12 TraesCS4A01G127800 chr5A 601267787 601270732 2945 False 4817 4817 96.236 1 2936 1 chr5A.!!$F1 2935
13 TraesCS4A01G127800 chr1A 442540182 442543128 2946 False 4844 4844 96.406 1 2936 1 chr1A.!!$F2 2935
14 TraesCS4A01G127800 chr1A 4489425 4492375 2950 True 4798 4798 96.104 1 2936 1 chr1A.!!$R1 2935
15 TraesCS4A01G127800 chr1A 181523884 181526826 2942 True 4796 4796 96.134 1 2936 1 chr1A.!!$R2 2935
16 TraesCS4A01G127800 chr1A 194446659 194449608 2949 False 4721 4721 95.630 1 2936 1 chr1A.!!$F1 2935
17 TraesCS4A01G127800 chr6A 550809460 550812407 2947 True 4802 4802 96.134 1 2936 1 chr6A.!!$R1 2935

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
427 434 0.462759 CTTCACAAGATCCTCCGCCC 60.463 60.0 0.0 0.0 0.00 6.13 F
1414 1438 0.179012 GAACAAGGACAACCCCCGAA 60.179 55.0 0.0 0.0 36.73 4.30 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1571 1596 1.191489 TGCTCCATTGGGTGTCGAGA 61.191 55.000 2.09 0.0 34.93 4.04 R
2897 2928 3.004629 TGACGGCGTTTCTAAGACTACAA 59.995 43.478 16.19 0.0 0.00 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 230 2.124736 GGGCTGCCGCAGTAATCA 60.125 61.111 21.29 0.00 38.10 2.57
396 401 1.598130 AGAACAGTGCGCCTTCACC 60.598 57.895 4.18 0.00 37.68 4.02
427 434 0.462759 CTTCACAAGATCCTCCGCCC 60.463 60.000 0.00 0.00 0.00 6.13
472 479 1.372997 GTCTGTTCGAGCTTCGCCA 60.373 57.895 0.00 0.00 40.21 5.69
550 557 0.498685 AGGGGAAGGGGAAGAAGTCT 59.501 55.000 0.00 0.00 0.00 3.24
815 823 1.340248 TCTTGAACTTCTTCGGAGCGT 59.660 47.619 0.00 0.00 0.00 5.07
1116 1139 3.382111 CAGTCGACTGGGCTTCCT 58.618 61.111 33.36 0.00 40.20 3.36
1377 1401 1.002087 GACGAGATGTTGGAAGGGTGT 59.998 52.381 0.00 0.00 0.00 4.16
1414 1438 0.179012 GAACAAGGACAACCCCCGAA 60.179 55.000 0.00 0.00 36.73 4.30
1420 1444 3.623703 GACAACCCCCGAAGAGCCC 62.624 68.421 0.00 0.00 0.00 5.19
1571 1596 4.346418 CCTCTAGGCCATTACTGAGATGTT 59.654 45.833 5.01 0.00 0.00 2.71
2801 2827 1.284715 CTGTACACGGTCGACTGCA 59.715 57.895 24.25 12.66 0.00 4.41
2916 2947 2.665052 GGTTGTAGTCTTAGAAACGCCG 59.335 50.000 0.00 0.00 0.00 6.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 2.158957 AGGCGACTGAAAGAAGTTGACA 60.159 45.455 0.00 0.00 41.52 3.58
214 217 0.179048 CCCATCTGATTACTGCGGCA 60.179 55.000 1.29 1.29 0.00 5.69
227 230 1.133009 AGCTTCCGTCCTATCCCATCT 60.133 52.381 0.00 0.00 0.00 2.90
378 383 1.598130 GGTGAAGGCGCACTGTTCT 60.598 57.895 10.83 0.00 38.78 3.01
396 401 2.108250 TCTTGTGAAGGAAGGGGGAAAG 59.892 50.000 0.00 0.00 0.00 2.62
427 434 2.125912 CAACGTGAGAGCGGAGGG 60.126 66.667 0.00 0.00 35.98 4.30
472 479 0.965866 TCTCCTTCACCATCGTCGCT 60.966 55.000 0.00 0.00 0.00 4.93
550 557 2.272146 GAAGATCCGCCCCAAGCA 59.728 61.111 0.00 0.00 44.04 3.91
815 823 3.719871 TGGGAGTAAAGTGATGGAGCTA 58.280 45.455 0.00 0.00 0.00 3.32
993 1014 3.973425 ACTTTTTCCCCTCATCTGGATG 58.027 45.455 4.36 4.36 40.09 3.51
1023 1044 4.712337 ACTGACTCGGGAAAAGTGATAGAT 59.288 41.667 0.00 0.00 0.00 1.98
1116 1139 3.997021 GTGCTCGATTCAGAGAAAAAGGA 59.003 43.478 8.92 0.00 40.57 3.36
1377 1401 2.753452 GTTCCCTGTGATACTCGACAGA 59.247 50.000 0.00 0.00 41.90 3.41
1473 1497 2.143122 GCAAGATCACAGTCGGAAACA 58.857 47.619 0.00 0.00 0.00 2.83
1571 1596 1.191489 TGCTCCATTGGGTGTCGAGA 61.191 55.000 2.09 0.00 34.93 4.04
2590 2616 8.643324 GTGGGTGTACAGATATAAAGATCTTCT 58.357 37.037 8.78 0.00 33.75 2.85
2897 2928 3.004629 TGACGGCGTTTCTAAGACTACAA 59.995 43.478 16.19 0.00 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.