Multiple sequence alignment - TraesCS4A01G073100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G073100 chr4A 100.000 3350 0 0 1 3350 72015522 72018871 0 6187
1 TraesCS4A01G073100 chr4A 98.110 2751 44 1 1 2751 446472763 446475505 0 4785
2 TraesCS4A01G073100 chr4A 98.146 2751 37 2 1 2751 537233673 537230937 0 4785
3 TraesCS4A01G073100 chr2A 98.190 2763 37 3 1 2759 69201456 69198703 0 4813
4 TraesCS4A01G073100 chr2A 98.168 655 12 0 2696 3350 738427940 738428594 0 1144
5 TraesCS4A01G073100 chr2B 98.078 2757 39 2 1 2751 39426055 39428803 0 4785
6 TraesCS4A01G073100 chr7B 98.001 2751 47 1 1 2751 147534659 147537401 0 4769
7 TraesCS4A01G073100 chr7B 98.015 655 13 0 2696 3350 580864496 580863842 0 1138
8 TraesCS4A01G073100 chr1A 97.969 2757 42 2 1 2751 58179558 58182306 0 4769
9 TraesCS4A01G073100 chr3B 97.896 2757 42 4 1 2751 85117940 85115194 0 4756
10 TraesCS4A01G073100 chr3B 98.323 656 10 1 2696 3350 85113437 85112782 0 1149
11 TraesCS4A01G073100 chr3B 98.321 655 11 0 2696 3350 149237709 149237055 0 1149
12 TraesCS4A01G073100 chr7A 97.722 2766 40 3 1 2751 105263301 105260544 0 4737
13 TraesCS4A01G073100 chr7A 98.321 655 11 0 2696 3350 121050458 121051112 0 1149
14 TraesCS4A01G073100 chr7A 98.168 655 11 1 2696 3350 22965724 22966377 0 1142
15 TraesCS4A01G073100 chr6B 97.819 2751 45 3 1 2751 663847564 663850299 0 4734
16 TraesCS4A01G073100 chrUn 98.626 655 9 0 2696 3350 291791414 291792068 0 1160
17 TraesCS4A01G073100 chr5B 98.168 655 12 0 2696 3350 579535497 579536151 0 1144
18 TraesCS4A01G073100 chr6A 98.015 655 13 0 2696 3350 116918016 116917362 0 1138


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G073100 chr4A 72015522 72018871 3349 False 6187.0 6187 100.0000 1 3350 1 chr4A.!!$F1 3349
1 TraesCS4A01G073100 chr4A 446472763 446475505 2742 False 4785.0 4785 98.1100 1 2751 1 chr4A.!!$F2 2750
2 TraesCS4A01G073100 chr4A 537230937 537233673 2736 True 4785.0 4785 98.1460 1 2751 1 chr4A.!!$R1 2750
3 TraesCS4A01G073100 chr2A 69198703 69201456 2753 True 4813.0 4813 98.1900 1 2759 1 chr2A.!!$R1 2758
4 TraesCS4A01G073100 chr2A 738427940 738428594 654 False 1144.0 1144 98.1680 2696 3350 1 chr2A.!!$F1 654
5 TraesCS4A01G073100 chr2B 39426055 39428803 2748 False 4785.0 4785 98.0780 1 2751 1 chr2B.!!$F1 2750
6 TraesCS4A01G073100 chr7B 147534659 147537401 2742 False 4769.0 4769 98.0010 1 2751 1 chr7B.!!$F1 2750
7 TraesCS4A01G073100 chr7B 580863842 580864496 654 True 1138.0 1138 98.0150 2696 3350 1 chr7B.!!$R1 654
8 TraesCS4A01G073100 chr1A 58179558 58182306 2748 False 4769.0 4769 97.9690 1 2751 1 chr1A.!!$F1 2750
9 TraesCS4A01G073100 chr3B 85112782 85117940 5158 True 2952.5 4756 98.1095 1 3350 2 chr3B.!!$R2 3349
10 TraesCS4A01G073100 chr3B 149237055 149237709 654 True 1149.0 1149 98.3210 2696 3350 1 chr3B.!!$R1 654
11 TraesCS4A01G073100 chr7A 105260544 105263301 2757 True 4737.0 4737 97.7220 1 2751 1 chr7A.!!$R1 2750
12 TraesCS4A01G073100 chr7A 121050458 121051112 654 False 1149.0 1149 98.3210 2696 3350 1 chr7A.!!$F2 654
13 TraesCS4A01G073100 chr7A 22965724 22966377 653 False 1142.0 1142 98.1680 2696 3350 1 chr7A.!!$F1 654
14 TraesCS4A01G073100 chr6B 663847564 663850299 2735 False 4734.0 4734 97.8190 1 2751 1 chr6B.!!$F1 2750
15 TraesCS4A01G073100 chrUn 291791414 291792068 654 False 1160.0 1160 98.6260 2696 3350 1 chrUn.!!$F1 654
16 TraesCS4A01G073100 chr5B 579535497 579536151 654 False 1144.0 1144 98.1680 2696 3350 1 chr5B.!!$F1 654
17 TraesCS4A01G073100 chr6A 116917362 116918016 654 True 1138.0 1138 98.0150 2696 3350 1 chr6A.!!$R1 654

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
849 859 0.172803 GGACACGATTACGCCTGAGT 59.827 55.0 0.0 0.0 43.96 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2649 2681 0.535102 GCAGCGCCTATATGTTGGGT 60.535 55.0 2.29 0.0 0.0 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 1.608025 GGTGTCCGCTCTTGTTGATCA 60.608 52.381 0.00 0.00 0.00 2.92
377 387 6.183360 TGCTCGTGTGTATATGTGGTACATTA 60.183 38.462 0.00 0.00 44.52 1.90
442 452 1.244019 GGATGTGGCTGAAGGCGTTT 61.244 55.000 0.00 0.00 44.42 3.60
791 801 2.933495 TCGTTTCCGAGATGACGAAT 57.067 45.000 0.00 0.00 41.01 3.34
849 859 0.172803 GGACACGATTACGCCTGAGT 59.827 55.000 0.00 0.00 43.96 3.41
1189 1199 5.415221 TGTGTGCGTATTGTCTAATCATCA 58.585 37.500 0.00 0.00 0.00 3.07
1789 1799 6.089920 TGTTGCGAAGTTTGATATCTTACG 57.910 37.500 3.98 3.25 0.00 3.18
1837 1847 4.258543 CCAAGAAGTTAAGGCGGTTATCA 58.741 43.478 0.00 0.00 0.00 2.15
2091 2101 6.408869 TGAGCTTGATGATGACATGACTTTA 58.591 36.000 0.00 0.00 36.82 1.85
2139 2149 1.301293 GTTCAAGCCTAGGCAGCCT 59.699 57.895 34.70 20.63 44.88 4.58
2474 2502 7.138736 CGAACCTGAAGTAATGTTGAATTGTT 58.861 34.615 0.00 0.00 0.00 2.83
2837 4674 3.951775 TCCAAATTAAATGCAGGCGTT 57.048 38.095 0.00 0.00 0.00 4.84
3090 4927 0.419865 TGTCCTCCACCCCCTTCATA 59.580 55.000 0.00 0.00 0.00 2.15
3264 5101 1.303561 GGCCAAGATCACCACTGCA 60.304 57.895 0.00 0.00 0.00 4.41
3314 5151 4.404098 GGCCTACACCACCACCGG 62.404 72.222 0.00 0.00 0.00 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 2.284995 GGGTCTCTGGCCTCCACT 60.285 66.667 3.32 0.00 0.00 4.00
93 94 1.010574 GAGACATCCTCGAGCGTCG 60.011 63.158 6.99 0.00 42.10 5.12
377 387 3.071023 TCAGGAAACAAAGTCCTCGACAT 59.929 43.478 0.00 0.00 44.00 3.06
442 452 3.382227 TCCATTTGCTATCGAAGACGGTA 59.618 43.478 0.00 0.00 42.51 4.02
791 801 6.942005 ACTTTTGGTACATGAGATTGACATCA 59.058 34.615 0.00 0.00 39.30 3.07
849 859 7.562821 GGACTAAAGTAATGACCTCCTTACCTA 59.437 40.741 0.00 0.00 0.00 3.08
1189 1199 3.515602 AGCACAATCAAAAGGAGTCCT 57.484 42.857 5.62 5.62 33.87 3.85
1626 1636 3.588057 TTGATCTCGGTGCGCTGCA 62.588 57.895 9.73 0.00 35.60 4.41
1789 1799 1.656429 CGCTGTAACACGAACAAGTGC 60.656 52.381 0.00 0.00 45.45 4.40
2649 2681 0.535102 GCAGCGCCTATATGTTGGGT 60.535 55.000 2.29 0.00 0.00 4.51
3090 4927 6.194235 TGCCATTTTCATAGGTATGGAAACT 58.806 36.000 5.71 0.00 42.27 2.66
3138 4975 5.006941 GCTCAATGCTTGTGTTGTCATTTTT 59.993 36.000 0.00 0.00 38.95 1.94
3264 5101 1.210204 AGGCAGTGGTGATGGTGGAT 61.210 55.000 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.