Multiple sequence alignment - TraesCS4A01G070400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G070400 chr4A 100.000 1605 0 0 627 2231 67599264 67600868 0 2964
1 TraesCS4A01G070400 chr4A 100.000 390 0 0 1 390 67598638 67599027 0 721
2 TraesCS4A01G070400 chr5A 98.007 1606 31 1 627 2231 238820508 238818903 0 2787
3 TraesCS4A01G070400 chr5A 98.718 390 5 0 1 390 19246982 19246593 0 693
4 TraesCS4A01G070400 chr7A 98.009 1607 25 3 627 2231 60281613 60283214 0 2784
5 TraesCS4A01G070400 chr7A 97.447 1606 35 2 627 2231 120838623 120837023 0 2734
6 TraesCS4A01G070400 chrUn 97.948 1608 25 3 627 2231 186206121 186204519 0 2780
7 TraesCS4A01G070400 chrUn 98.462 390 6 0 1 390 434805431 434805820 0 688
8 TraesCS4A01G070400 chr7B 97.822 1607 28 3 627 2231 742991746 742993347 0 2767
9 TraesCS4A01G070400 chr7B 97.761 1608 28 3 627 2231 716876481 716874879 0 2763
10 TraesCS4A01G070400 chr7B 98.462 390 6 0 1 390 742991306 742991695 0 688
11 TraesCS4A01G070400 chr7B 98.205 390 7 0 1 390 716836709 716836320 0 682
12 TraesCS4A01G070400 chr7B 98.205 390 7 0 1 390 716876920 716876531 0 682
13 TraesCS4A01G070400 chr2B 97.698 1607 30 3 627 2231 391163309 391164910 0 2756
14 TraesCS4A01G070400 chr2B 97.512 1608 32 4 627 2231 112843502 112845104 0 2741
15 TraesCS4A01G070400 chr1A 97.698 1607 30 3 627 2231 498688927 498687326 0 2756
16 TraesCS4A01G070400 chr7D 98.718 390 5 0 1 390 382051940 382052329 0 693
17 TraesCS4A01G070400 chr7D 98.462 390 6 0 1 390 381925862 381926251 0 688
18 TraesCS4A01G070400 chr7D 98.462 390 6 0 1 390 381971909 381971520 0 688
19 TraesCS4A01G070400 chr4D 98.462 390 6 0 1 390 123337332 123337721 0 688


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G070400 chr4A 67598638 67600868 2230 False 1842.5 2964 100.000 1 2231 2 chr4A.!!$F1 2230
1 TraesCS4A01G070400 chr5A 238818903 238820508 1605 True 2787.0 2787 98.007 627 2231 1 chr5A.!!$R2 1604
2 TraesCS4A01G070400 chr7A 60281613 60283214 1601 False 2784.0 2784 98.009 627 2231 1 chr7A.!!$F1 1604
3 TraesCS4A01G070400 chr7A 120837023 120838623 1600 True 2734.0 2734 97.447 627 2231 1 chr7A.!!$R1 1604
4 TraesCS4A01G070400 chrUn 186204519 186206121 1602 True 2780.0 2780 97.948 627 2231 1 chrUn.!!$R1 1604
5 TraesCS4A01G070400 chr7B 742991306 742993347 2041 False 1727.5 2767 98.142 1 2231 2 chr7B.!!$F1 2230
6 TraesCS4A01G070400 chr7B 716874879 716876920 2041 True 1722.5 2763 97.983 1 2231 2 chr7B.!!$R2 2230
7 TraesCS4A01G070400 chr2B 391163309 391164910 1601 False 2756.0 2756 97.698 627 2231 1 chr2B.!!$F2 1604
8 TraesCS4A01G070400 chr2B 112843502 112845104 1602 False 2741.0 2741 97.512 627 2231 1 chr2B.!!$F1 1604
9 TraesCS4A01G070400 chr1A 498687326 498688927 1601 True 2756.0 2756 97.698 627 2231 1 chr1A.!!$R1 1604

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
52 53 0.965439 CTCATTTGGGGCGGAAAACA 59.035 50.0 0.0 0.0 0.00 2.83 F
645 646 2.146920 GGCAGAGGGTCTGTAGTACT 57.853 55.0 0.0 0.0 45.94 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1170 1176 1.406751 CCATCATACGGCTCACCAACA 60.407 52.381 0.0 0.0 34.57 3.33 R
1696 1707 3.623960 CACGCCCGTATCAATCCTTTAAA 59.376 43.478 0.0 0.0 0.00 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
52 53 0.965439 CTCATTTGGGGCGGAAAACA 59.035 50.000 0.00 0.0 0.00 2.83
171 172 3.737172 GCCAATGGCGCACGAAGT 61.737 61.111 9.14 0.0 40.21 3.01
222 223 3.650950 GTGGGGGAGAAGCAGCCA 61.651 66.667 0.00 0.0 0.00 4.75
645 646 2.146920 GGCAGAGGGTCTGTAGTACT 57.853 55.000 0.00 0.0 45.94 2.73
710 716 4.012374 GTGCCTACTACTACACCACACTA 58.988 47.826 0.00 0.0 0.00 2.74
772 778 3.172106 TGGCAGAACGTTGGGGGA 61.172 61.111 5.00 0.0 0.00 4.81
1003 1009 5.612261 TGATCATTTTGATAGAGGGGGATGA 59.388 40.000 0.00 0.0 37.20 2.92
1170 1176 1.216990 CCCCCTTAGAGGCAAGTGAT 58.783 55.000 0.00 0.0 32.73 3.06
1548 1555 6.963322 AGATAGGCTTTACTGGACATTTTCT 58.037 36.000 0.00 0.0 0.00 2.52
1696 1707 4.102838 TCCTAACGCTAGTCTAGTCTCCAT 59.897 45.833 8.68 0.0 0.00 3.41
1727 1738 2.180159 ATACGGGCGTGCTTCCTTGT 62.180 55.000 0.00 0.0 0.00 3.16
1958 1969 0.532862 GGCACCCCATCACTATCGTG 60.533 60.000 0.00 0.0 42.59 4.35
2018 2029 4.139786 ACTTCTACCCATCTACGCGATTA 58.860 43.478 15.93 0.0 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 1.019278 CCCTTACGCATGCACTTCGT 61.019 55.000 19.57 9.46 39.88 3.85
171 172 2.749839 GTGCCCCTTACGCATGCA 60.750 61.111 19.57 0.00 38.76 3.96
179 180 3.520317 TCTTTATTTCTCCGTGCCCCTTA 59.480 43.478 0.00 0.00 0.00 2.69
222 223 3.965888 AAGCGAAGGGAATGAGCTT 57.034 47.368 0.00 0.00 42.51 3.74
637 638 2.747989 CTCCAGTGCTTCGAGTACTACA 59.252 50.000 0.00 0.00 39.17 2.74
645 646 0.532573 GGATCACTCCAGTGCTTCGA 59.467 55.000 1.49 0.00 45.25 3.71
710 716 4.968259 TGTAAATGTGTAGAGCCAAGTGT 58.032 39.130 0.00 0.00 0.00 3.55
772 778 4.288531 GGATAACGAGTCGACGATTGAAT 58.711 43.478 21.50 1.01 37.03 2.57
834 840 0.178975 CGATAGGCTCCACTCCCTCT 60.179 60.000 0.00 0.00 32.65 3.69
838 844 0.032815 GCTTCGATAGGCTCCACTCC 59.967 60.000 0.00 0.00 0.00 3.85
872 878 3.117963 AGAATGAAGAGGAGCCAAGGATG 60.118 47.826 0.00 0.00 0.00 3.51
1003 1009 4.892934 TGAGTCTGTTTTGCCCACTTTATT 59.107 37.500 0.00 0.00 0.00 1.40
1059 1065 6.459066 AGATGATTCTTTCTTTGTCGAGACA 58.541 36.000 1.24 1.24 39.98 3.41
1170 1176 1.406751 CCATCATACGGCTCACCAACA 60.407 52.381 0.00 0.00 34.57 3.33
1318 1325 7.666804 TCCATTGGTTCATATAGAATCCATGTG 59.333 37.037 1.86 0.00 36.48 3.21
1548 1555 4.454504 GGAATTGTCTTCGCCTTTGTAAGA 59.545 41.667 0.00 0.00 0.00 2.10
1696 1707 3.623960 CACGCCCGTATCAATCCTTTAAA 59.376 43.478 0.00 0.00 0.00 1.52
1958 1969 7.278203 GCACCTAAGTTAGAGATTTCAACTACC 59.722 40.741 11.66 0.00 32.35 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.