Multiple sequence alignment - TraesCS4A01G070100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G070100 chr4A 100.000 2573 0 0 1 2573 67592137 67594709 0 4752
1 TraesCS4A01G070100 chr6D 98.913 2575 24 2 1 2573 124512881 124515453 0 4597
2 TraesCS4A01G070100 chr7D 98.757 2575 28 2 1 2573 203495356 203497928 0 4575
3 TraesCS4A01G070100 chr7D 98.680 2575 30 2 1 2573 381978405 381975833 0 4564
4 TraesCS4A01G070100 chr5A 98.490 2583 29 3 1 2573 19253502 19250920 0 4545
5 TraesCS4A01G070100 chr5A 98.214 2575 41 3 1 2573 238901414 238898843 0 4495
6 TraesCS4A01G070100 chr7B 98.374 2583 32 3 1 2573 716883434 716880852 0 4529
7 TraesCS4A01G070100 chr7B 98.180 2583 36 4 1 2573 716843193 716840612 0 4499
8 TraesCS4A01G070100 chr7B 98.064 2583 38 4 1 2573 742984791 742987371 0 4482
9 TraesCS4A01G070100 chr7A 97.910 2584 37 8 1 2573 120845805 120843228 0 4457


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G070100 chr4A 67592137 67594709 2572 False 4752 4752 100.000 1 2573 1 chr4A.!!$F1 2572
1 TraesCS4A01G070100 chr6D 124512881 124515453 2572 False 4597 4597 98.913 1 2573 1 chr6D.!!$F1 2572
2 TraesCS4A01G070100 chr7D 203495356 203497928 2572 False 4575 4575 98.757 1 2573 1 chr7D.!!$F1 2572
3 TraesCS4A01G070100 chr7D 381975833 381978405 2572 True 4564 4564 98.680 1 2573 1 chr7D.!!$R1 2572
4 TraesCS4A01G070100 chr5A 19250920 19253502 2582 True 4545 4545 98.490 1 2573 1 chr5A.!!$R1 2572
5 TraesCS4A01G070100 chr5A 238898843 238901414 2571 True 4495 4495 98.214 1 2573 1 chr5A.!!$R2 2572
6 TraesCS4A01G070100 chr7B 716880852 716883434 2582 True 4529 4529 98.374 1 2573 1 chr7B.!!$R2 2572
7 TraesCS4A01G070100 chr7B 716840612 716843193 2581 True 4499 4499 98.180 1 2573 1 chr7B.!!$R1 2572
8 TraesCS4A01G070100 chr7B 742984791 742987371 2580 False 4482 4482 98.064 1 2573 1 chr7B.!!$F1 2572
9 TraesCS4A01G070100 chr7A 120843228 120845805 2577 True 4457 4457 97.910 1 2573 1 chr7A.!!$R1 2572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
813 817 3.371898 CGATTCAACACTAGAGCATGCAA 59.628 43.478 21.98 3.7 0.0 4.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1893 1901 0.104855 ACACTGAGCGAGCAACAAGA 59.895 50.0 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 122 9.350357 TCGTACAGTTGAATTAAGTTGATCTAC 57.650 33.333 0.00 0.0 0.00 2.59
662 666 5.107337 CGCAGTAAGGATACGAATACGACTA 60.107 44.000 0.00 0.0 46.39 2.59
813 817 3.371898 CGATTCAACACTAGAGCATGCAA 59.628 43.478 21.98 3.7 0.00 4.08
1893 1901 4.202430 CCCCTACGGAAACTATTGCCTATT 60.202 45.833 0.00 0.0 0.00 1.73
1898 1906 5.497474 ACGGAAACTATTGCCTATTCTTGT 58.503 37.500 0.00 0.0 0.00 3.16
2019 2027 5.766222 GTTCATTCACTTGCTCATGAACTT 58.234 37.500 13.99 0.0 46.42 2.66
2374 2390 8.740123 TGTAAATCTGTTGAAGGTTTTCTACA 57.260 30.769 4.90 4.9 43.47 2.74
2381 2397 7.996644 TCTGTTGAAGGTTTTCTACATAGGTTT 59.003 33.333 5.33 0.0 44.20 3.27
2406 2422 1.228245 TGCCTCTCCCACTTGTTGC 60.228 57.895 0.00 0.0 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
121 122 3.129871 GCAGTTAAGGCAGCTAGATCTG 58.870 50.000 5.18 0.0 37.15 2.90
123 124 2.131183 CGCAGTTAAGGCAGCTAGATC 58.869 52.381 0.00 0.0 0.00 2.75
735 739 1.226859 CCGCTAAACCATCGCTCGA 60.227 57.895 0.00 0.0 0.00 4.04
813 817 9.931698 TTATATAGTTATGTATCCAGGATCGGT 57.068 33.333 4.75 0.0 0.00 4.69
1893 1901 0.104855 ACACTGAGCGAGCAACAAGA 59.895 50.000 0.00 0.0 0.00 3.02
1898 1906 0.958822 TACTGACACTGAGCGAGCAA 59.041 50.000 0.00 0.0 0.00 3.91
2045 2053 3.391382 CGGCGGAGGAAAGGAGGT 61.391 66.667 0.00 0.0 0.00 3.85
2348 2364 9.349713 TGTAGAAAACCTTCAACAGATTTACAT 57.650 29.630 0.00 0.0 33.64 2.29
2374 2390 3.137360 GGAGAGGCAGGATTCAAACCTAT 59.863 47.826 0.00 0.0 35.84 2.57
2381 2397 0.252881 AGTGGGAGAGGCAGGATTCA 60.253 55.000 0.00 0.0 0.00 2.57
2406 2422 7.033185 GCCTACTTTCTCTTCTCTTAAGTCTG 58.967 42.308 1.63 0.0 31.94 3.51
2543 2559 7.362234 TCTCGATTGGATATAGATGGGGAATA 58.638 38.462 0.00 0.0 0.00 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.