Multiple sequence alignment - TraesCS4A01G069500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G069500 chr4A 100.000 2192 0 0 1 2192 67519499 67521690 0.000000e+00 4048.0
1 TraesCS4A01G069500 chr3A 97.856 2192 47 0 1 2192 495104759 495102568 0.000000e+00 3788.0
2 TraesCS4A01G069500 chr3A 88.664 494 46 5 352 837 21284878 21284387 5.210000e-166 593.0
3 TraesCS4A01G069500 chr3A 98.020 303 4 2 1598 1899 482776520 482776219 1.930000e-145 525.0
4 TraesCS4A01G069500 chr3A 96.154 52 2 0 1328 1379 737346036 737346087 3.880000e-13 86.1
5 TraesCS4A01G069500 chr2B 97.765 2192 49 0 1 2192 234541159 234538968 0.000000e+00 3777.0
6 TraesCS4A01G069500 chr1A 97.765 2192 48 1 1 2192 278521195 278523385 0.000000e+00 3775.0
7 TraesCS4A01G069500 chr3B 97.721 2194 45 3 1 2192 92296731 92294541 0.000000e+00 3770.0
8 TraesCS4A01G069500 chr3B 97.536 2192 53 1 1 2192 6010765 6008575 0.000000e+00 3747.0
9 TraesCS4A01G069500 chr1B 97.582 2192 52 1 1 2192 619195330 619193140 0.000000e+00 3753.0
10 TraesCS4A01G069500 chr7A 97.400 2192 57 0 1 2192 563522097 563519906 0.000000e+00 3733.0
11 TraesCS4A01G069500 chr2A 100.000 204 0 0 1682 1885 113953700 113953903 5.710000e-101 377.0
12 TraesCS4A01G069500 chr2A 95.139 144 6 1 426 569 65286234 65286092 2.190000e-55 226.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G069500 chr4A 67519499 67521690 2191 False 4048 4048 100.000 1 2192 1 chr4A.!!$F1 2191
1 TraesCS4A01G069500 chr3A 495102568 495104759 2191 True 3788 3788 97.856 1 2192 1 chr3A.!!$R3 2191
2 TraesCS4A01G069500 chr2B 234538968 234541159 2191 True 3777 3777 97.765 1 2192 1 chr2B.!!$R1 2191
3 TraesCS4A01G069500 chr1A 278521195 278523385 2190 False 3775 3775 97.765 1 2192 1 chr1A.!!$F1 2191
4 TraesCS4A01G069500 chr3B 92294541 92296731 2190 True 3770 3770 97.721 1 2192 1 chr3B.!!$R2 2191
5 TraesCS4A01G069500 chr3B 6008575 6010765 2190 True 3747 3747 97.536 1 2192 1 chr3B.!!$R1 2191
6 TraesCS4A01G069500 chr1B 619193140 619195330 2190 True 3753 3753 97.582 1 2192 1 chr1B.!!$R1 2191
7 TraesCS4A01G069500 chr7A 563519906 563522097 2191 True 3733 3733 97.400 1 2192 1 chr7A.!!$R1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
654 655 0.681733 GGATTCGCATCTGGCCTCTA 59.318 55.0 3.32 0.0 40.31 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2049 2052 1.446907 CGGCAAGCTTGTTCTGATCT 58.553 50.0 26.55 0.0 0.0 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 2.371179 CTCATGCTATGGATGTGGGAGT 59.629 50.000 0.00 0.00 0.00 3.85
77 78 2.105306 TCATGCTATGGATGTGGGAGTG 59.895 50.000 0.00 0.00 0.00 3.51
499 500 0.836606 TGTGTGAAGCCTTGGAGACA 59.163 50.000 0.00 0.00 39.83 3.41
590 591 2.158143 AGATTCCTATTCTAGGCGGGGT 60.158 50.000 0.00 0.00 45.82 4.95
654 655 0.681733 GGATTCGCATCTGGCCTCTA 59.318 55.000 3.32 0.00 40.31 2.43
832 833 2.646175 GGCCGAGCTGTAGGTCACA 61.646 63.158 11.18 0.00 42.28 3.58
869 870 1.073722 TGGCTGACTGGGCTTTCTG 59.926 57.895 0.00 0.00 0.00 3.02
1395 1398 1.148273 GGGTATGCTGGGATTCGCA 59.852 57.895 3.19 3.19 40.87 5.10
1414 1417 1.461127 CAAAGAGCAGCACCTTACGAC 59.539 52.381 0.00 0.00 0.00 4.34
1545 1548 5.655974 TGCAATGTCCTAATCAAATGCCTAA 59.344 36.000 0.00 0.00 33.72 2.69
1617 1620 7.282585 TCTCGAATGAAACTATCCATGGAATT 58.717 34.615 20.67 11.91 0.00 2.17
2025 2028 2.830285 GCGTTCGTGGTGGTGCTTT 61.830 57.895 0.00 0.00 0.00 3.51
2049 2052 2.552599 TTCCAATGTACTGCGTCCAA 57.447 45.000 0.00 0.00 0.00 3.53
2059 2062 1.344438 ACTGCGTCCAAGATCAGAACA 59.656 47.619 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
499 500 2.761213 CCTAGCCCCGGGTACGTT 60.761 66.667 21.85 4.59 38.78 3.99
590 591 0.331278 ATTCGAAGGTTGATGGCCCA 59.669 50.000 3.35 0.00 0.00 5.36
654 655 3.240134 ATGCGGTTCTGACGTGCCT 62.240 57.895 0.00 0.00 0.00 4.75
832 833 0.110486 ACCTTTTCGGTGCAGGTCAT 59.890 50.000 0.00 0.00 46.80 3.06
869 870 0.942962 CTGATCCGCTTTGATCCAGC 59.057 55.000 4.25 4.25 40.37 4.85
916 917 1.451207 CATTCGATGTTCCGGGGCA 60.451 57.895 0.00 0.58 0.00 5.36
1395 1398 1.797025 GTCGTAAGGTGCTGCTCTTT 58.203 50.000 12.37 8.77 38.47 2.52
1414 1417 2.826428 AGATCCGATTGGTCATGAACG 58.174 47.619 6.21 3.75 36.30 3.95
1473 1476 7.626664 GCATCTCTTCGATACGGATACAGTAAT 60.627 40.741 0.00 0.00 0.00 1.89
1545 1548 1.611977 CATCGGCTTTCATCATGCCAT 59.388 47.619 0.00 0.00 44.60 4.40
1555 1558 2.474816 AGCTTACGATCATCGGCTTTC 58.525 47.619 12.67 0.00 45.59 2.62
1617 1620 3.931130 CGTTTCACACGGCGCACA 61.931 61.111 10.83 0.00 45.89 4.57
1897 1900 2.359900 CCACAACCTTGATGTCTAGCC 58.640 52.381 0.00 0.00 0.00 3.93
2049 2052 1.446907 CGGCAAGCTTGTTCTGATCT 58.553 50.000 26.55 0.00 0.00 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.