Multiple sequence alignment - TraesCS4A01G069400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G069400 chr4A 100.000 2465 0 0 1 2465 67518421 67520885 0 4553
1 TraesCS4A01G069400 chr3B 98.581 2467 30 3 1 2465 92297809 92295346 0 4357
2 TraesCS4A01G069400 chr3B 98.215 2465 43 1 1 2465 6011843 6009380 0 4307
3 TraesCS4A01G069400 chr3A 98.499 2465 37 0 1 2465 495105837 495103373 0 4348
4 TraesCS4A01G069400 chr2B 98.418 2465 39 0 1 2465 234542237 234539773 0 4337
5 TraesCS4A01G069400 chr7A 98.337 2465 41 0 1 2465 563523175 563520711 0 4325
6 TraesCS4A01G069400 chrUn 98.215 2465 43 1 1 2465 217906591 217909054 0 4307
7 TraesCS4A01G069400 chr1B 97.810 2466 53 1 1 2465 619196409 619193944 0 4253


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G069400 chr4A 67518421 67520885 2464 False 4553 4553 100.000 1 2465 1 chr4A.!!$F1 2464
1 TraesCS4A01G069400 chr3B 92295346 92297809 2463 True 4357 4357 98.581 1 2465 1 chr3B.!!$R2 2464
2 TraesCS4A01G069400 chr3B 6009380 6011843 2463 True 4307 4307 98.215 1 2465 1 chr3B.!!$R1 2464
3 TraesCS4A01G069400 chr3A 495103373 495105837 2464 True 4348 4348 98.499 1 2465 1 chr3A.!!$R1 2464
4 TraesCS4A01G069400 chr2B 234539773 234542237 2464 True 4337 4337 98.418 1 2465 1 chr2B.!!$R1 2464
5 TraesCS4A01G069400 chr7A 563520711 563523175 2464 True 4325 4325 98.337 1 2465 1 chr7A.!!$R1 2464
6 TraesCS4A01G069400 chrUn 217906591 217909054 2463 False 4307 4307 98.215 1 2465 1 chrUn.!!$F1 2464
7 TraesCS4A01G069400 chr1B 619193944 619196409 2465 True 4253 4253 97.810 1 2465 1 chr1B.!!$R1 2464

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
627 628 1.21225 TAGAACCCAGCCCCCTTTCC 61.212 60.0 0.0 0.0 0.0 3.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1910 1912 0.110486 ACCTTTTCGGTGCAGGTCAT 59.89 50.0 0.0 0.0 46.8 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
578 579 4.737855 AGGCGCACTTCTCTTATTCTTA 57.262 40.909 10.83 0.0 0.00 2.10
627 628 1.212250 TAGAACCCAGCCCCCTTTCC 61.212 60.000 0.00 0.0 0.00 3.13
764 766 1.497286 CTAGACTAGGAGCCCCACTCT 59.503 57.143 1.11 0.0 45.48 3.24
1154 1156 2.371179 CTCATGCTATGGATGTGGGAGT 59.629 50.000 0.00 0.0 0.00 3.85
1155 1157 2.105306 TCATGCTATGGATGTGGGAGTG 59.895 50.000 0.00 0.0 0.00 3.51
1577 1579 0.836606 TGTGTGAAGCCTTGGAGACA 59.163 50.000 0.00 0.0 39.83 3.41
1668 1670 2.158143 AGATTCCTATTCTAGGCGGGGT 60.158 50.000 0.00 0.0 45.82 4.95
1732 1734 0.681733 GGATTCGCATCTGGCCTCTA 59.318 55.000 3.32 0.0 40.31 2.43
1910 1912 2.646175 GGCCGAGCTGTAGGTCACA 61.646 63.158 11.18 0.0 42.28 3.58
1947 1949 1.073722 TGGCTGACTGGGCTTTCTG 59.926 57.895 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
572 573 3.117738 CAGGAGGTGAAGGCCATAAGAAT 60.118 47.826 5.01 0.00 0.00 2.40
578 579 2.679716 GCAGGAGGTGAAGGCCAT 59.320 61.111 5.01 0.00 0.00 4.40
627 628 3.181494 TGCTTGCAGAAATGAATGGATCG 60.181 43.478 0.00 0.00 0.00 3.69
764 766 0.530288 GCTGGGCGCCTTTTGAATAA 59.470 50.000 28.56 0.00 0.00 1.40
1577 1579 2.761213 CCTAGCCCCGGGTACGTT 60.761 66.667 21.85 4.59 38.78 3.99
1668 1670 0.331278 ATTCGAAGGTTGATGGCCCA 59.669 50.000 3.35 0.00 0.00 5.36
1732 1734 3.240134 ATGCGGTTCTGACGTGCCT 62.240 57.895 0.00 0.00 0.00 4.75
1910 1912 0.110486 ACCTTTTCGGTGCAGGTCAT 59.890 50.000 0.00 0.00 46.80 3.06
1947 1949 0.942962 CTGATCCGCTTTGATCCAGC 59.057 55.000 4.25 4.25 40.37 4.85
1994 1996 1.451207 CATTCGATGTTCCGGGGCA 60.451 57.895 0.00 0.58 0.00 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.