Multiple sequence alignment - TraesCS4A01G068000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G068000 chr4A 100.000 2900 0 0 1 2900 66552485 66555384 0 5356
1 TraesCS4A01G068000 chr7B 99.310 2900 20 0 1 2900 666520835 666523734 0 5245
2 TraesCS4A01G068000 chr7B 99.208 2903 20 3 1 2900 194133427 194130525 0 5230
3 TraesCS4A01G068000 chr6A 99.172 2900 24 0 1 2900 12687709 12690608 0 5223
4 TraesCS4A01G068000 chr6A 99.035 2902 26 2 1 2900 480643556 480640655 0 5203
5 TraesCS4A01G068000 chr6B 99.104 2901 23 2 1 2899 21358813 21361712 0 5210
6 TraesCS4A01G068000 chr7A 99.069 2901 25 2 1 2900 624753409 624756308 0 5206
7 TraesCS4A01G068000 chr7A 99.034 2900 28 0 1 2900 634136090 634133191 0 5201


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G068000 chr4A 66552485 66555384 2899 False 5356 5356 100.000 1 2900 1 chr4A.!!$F1 2899
1 TraesCS4A01G068000 chr7B 666520835 666523734 2899 False 5245 5245 99.310 1 2900 1 chr7B.!!$F1 2899
2 TraesCS4A01G068000 chr7B 194130525 194133427 2902 True 5230 5230 99.208 1 2900 1 chr7B.!!$R1 2899
3 TraesCS4A01G068000 chr6A 12687709 12690608 2899 False 5223 5223 99.172 1 2900 1 chr6A.!!$F1 2899
4 TraesCS4A01G068000 chr6A 480640655 480643556 2901 True 5203 5203 99.035 1 2900 1 chr6A.!!$R1 2899
5 TraesCS4A01G068000 chr6B 21358813 21361712 2899 False 5210 5210 99.104 1 2899 1 chr6B.!!$F1 2898
6 TraesCS4A01G068000 chr7A 624753409 624756308 2899 False 5206 5206 99.069 1 2900 1 chr7A.!!$F1 2899
7 TraesCS4A01G068000 chr7A 634133191 634136090 2899 True 5201 5201 99.034 1 2900 1 chr7A.!!$R1 2899

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
506 509 2.687425 CACACACAAATCTTGTCCCACA 59.313 45.455 0.0 0.0 43.23 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2168 2176 0.66688 GCACAAATGCGCACATCCAA 60.667 50.0 14.9 0.0 43.33 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
506 509 2.687425 CACACACAAATCTTGTCCCACA 59.313 45.455 0.00 0.0 43.23 4.17
1241 1248 5.678583 CCATACTCTTGATGACACAGGAAT 58.321 41.667 0.00 0.0 0.00 3.01
2168 2176 2.561419 ACGTGTCCTATTACTGTGCAGT 59.439 45.455 9.90 9.9 45.02 4.40
2829 2837 0.909610 TGCCGGAATCCAGGACTCTT 60.910 55.000 5.05 0.0 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
506 509 4.706842 GGTGTGGGACCAGAATATATGT 57.293 45.455 0.0 0.0 45.34 2.29
954 960 2.618816 CCACACACTCCCTGCACATATT 60.619 50.000 0.0 0.0 0.00 1.28
1241 1248 0.400213 ACCAGGAACATTTGCCTCGA 59.600 50.000 0.0 0.0 30.41 4.04
2168 2176 0.666880 GCACAAATGCGCACATCCAA 60.667 50.000 14.9 0.0 43.33 3.53
2321 2329 3.515502 CCCTCCTTTGTGTCATCTCTACA 59.484 47.826 0.0 0.0 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.