Multiple sequence alignment - TraesCS4A01G051200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G051200 chr4A 100.000 2171 0 0 1 2171 41993586 41991416 0 4010
1 TraesCS4A01G051200 chr6A 97.463 2168 53 2 1 2168 157442621 157444786 0 3698
2 TraesCS4A01G051200 chr6A 97.328 2171 57 1 1 2171 396287618 396285449 0 3687
3 TraesCS4A01G051200 chr6A 97.190 2171 60 1 1 2171 592291609 592293778 0 3670
4 TraesCS4A01G051200 chr2A 97.010 2174 61 2 1 2171 775077959 775075787 0 3651
5 TraesCS4A01G051200 chr7A 96.407 2171 77 1 1 2171 699467208 699469377 0 3576
6 TraesCS4A01G051200 chr5A 96.368 2175 75 1 1 2171 563160861 563158687 0 3576
7 TraesCS4A01G051200 chr1D 96.221 2170 65 4 5 2171 476465050 476467205 0 3537
8 TraesCS4A01G051200 chr3D 96.136 2174 64 5 5 2171 605514874 605517034 0 3531
9 TraesCS4A01G051200 chr7D 96.129 2170 66 5 5 2171 196131987 196129833 0 3526


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G051200 chr4A 41991416 41993586 2170 True 4010 4010 100.000 1 2171 1 chr4A.!!$R1 2170
1 TraesCS4A01G051200 chr6A 157442621 157444786 2165 False 3698 3698 97.463 1 2168 1 chr6A.!!$F1 2167
2 TraesCS4A01G051200 chr6A 396285449 396287618 2169 True 3687 3687 97.328 1 2171 1 chr6A.!!$R1 2170
3 TraesCS4A01G051200 chr6A 592291609 592293778 2169 False 3670 3670 97.190 1 2171 1 chr6A.!!$F2 2170
4 TraesCS4A01G051200 chr2A 775075787 775077959 2172 True 3651 3651 97.010 1 2171 1 chr2A.!!$R1 2170
5 TraesCS4A01G051200 chr7A 699467208 699469377 2169 False 3576 3576 96.407 1 2171 1 chr7A.!!$F1 2170
6 TraesCS4A01G051200 chr5A 563158687 563160861 2174 True 3576 3576 96.368 1 2171 1 chr5A.!!$R1 2170
7 TraesCS4A01G051200 chr1D 476465050 476467205 2155 False 3537 3537 96.221 5 2171 1 chr1D.!!$F1 2166
8 TraesCS4A01G051200 chr3D 605514874 605517034 2160 False 3531 3531 96.136 5 2171 1 chr3D.!!$F1 2166
9 TraesCS4A01G051200 chr7D 196129833 196131987 2154 True 3526 3526 96.129 5 2171 1 chr7D.!!$R1 2166

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
795 799 1.211212 CTCCATGGATGTGGCTGAAGA 59.789 52.381 16.63 0.0 39.19 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1775 1788 0.24912 CCTCATTATATGCCGGCGGA 59.751 55.0 33.44 15.74 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 508 1.367840 GCTATCGACGGGATGCCTT 59.632 57.895 0.28 0.00 36.55 4.35
631 635 4.445557 AGAAGAAGGAAAGGAAAGCAGT 57.554 40.909 0.00 0.00 0.00 4.40
795 799 1.211212 CTCCATGGATGTGGCTGAAGA 59.789 52.381 16.63 0.00 39.19 2.87
885 889 5.913137 AGTTGGTCTGTTTTGTGATCAAA 57.087 34.783 0.00 0.00 41.10 2.69
1017 1021 7.011482 GGTGGTAATATGCTTCTACTTTCTGTG 59.989 40.741 0.00 0.00 0.00 3.66
1168 1172 5.037385 CGAACGATGTCAATCTCATGTACT 58.963 41.667 0.00 0.00 0.00 2.73
1209 1213 0.175760 ACACGATTACGCCTGAGCAT 59.824 50.000 0.00 0.00 43.96 3.79
1251 1255 4.216902 CAGTCATTTCTCATGTTTGCCTGA 59.783 41.667 0.00 0.00 0.00 3.86
1321 1326 4.623814 CCATATGGCGCCGATGAT 57.376 55.556 32.11 19.71 0.00 2.45
1546 1552 4.439057 TGAACCGTATTGACTAAGCATCC 58.561 43.478 0.00 0.00 0.00 3.51
1609 1618 1.418097 TTGGACAGGAGAAGGCAGCA 61.418 55.000 0.00 0.00 0.00 4.41
1709 1718 1.746615 ACGCGCCAAGCTTCATGAT 60.747 52.632 5.73 0.00 45.59 2.45
1761 1774 7.336931 ACATACGATGGCTTCTTGAAAATACTT 59.663 33.333 0.00 0.00 33.60 2.24
1856 1869 3.910627 AGGGGAAGTACAACAGAGATGTT 59.089 43.478 0.00 0.00 32.27 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 508 5.164620 TCAGAATTGGTGCTCATACAGAA 57.835 39.130 0.00 0.00 0.00 3.02
631 635 1.664649 CACGTGAAAGCAGCTCCGA 60.665 57.895 10.90 0.00 0.00 4.55
1017 1021 2.844072 GAAGACGCTCCCAGCTCCAC 62.844 65.000 0.00 0.00 39.60 4.02
1035 1039 3.234630 CTTCGGGCGTCCAACAGGA 62.235 63.158 6.96 0.00 0.00 3.86
1209 1213 5.242171 TGACTGAAGTAATGACCTCGTTACA 59.758 40.000 16.29 0.18 45.86 2.41
1546 1552 6.506500 ACATTAGCAAAATCAAGGAGTGAG 57.493 37.500 0.00 0.00 40.43 3.51
1609 1618 4.323868 GCTTGTCCCAGTCCTTTATCTTCT 60.324 45.833 0.00 0.00 0.00 2.85
1705 1714 6.182627 TCAAAAGCAAGTGGACTATGATCAT 58.817 36.000 13.81 13.81 0.00 2.45
1709 1718 7.168219 AGTTATCAAAAGCAAGTGGACTATGA 58.832 34.615 0.00 0.00 0.00 2.15
1761 1774 1.067060 CGGCGGACATATCTCAACTCA 59.933 52.381 0.00 0.00 0.00 3.41
1775 1788 0.249120 CCTCATTATATGCCGGCGGA 59.751 55.000 33.44 15.74 0.00 5.54
1856 1869 1.076485 GACTCCGTGCCCTACCCTA 60.076 63.158 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.