Multiple sequence alignment - TraesCS4A01G050600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G050600 chr4A 100.000 2626 0 0 1 2626 41895263 41897888 0.000000e+00 4850
1 TraesCS4A01G050600 chr4A 91.871 1181 68 6 1 1176 725870613 725869456 0.000000e+00 1624
2 TraesCS4A01G050600 chr4A 92.402 408 20 5 1559 1965 725869206 725868809 2.930000e-159 571
3 TraesCS4A01G050600 chr4A 95.000 260 13 0 1252 1511 725869454 725869195 2.430000e-110 409
4 TraesCS4A01G050600 chr1A 98.135 2628 23 3 1 2626 452026618 452024015 0.000000e+00 4558
5 TraesCS4A01G050600 chr1A 94.303 1176 60 4 6 1176 548229640 548228467 0.000000e+00 1794
6 TraesCS4A01G050600 chr1A 93.699 730 28 7 1252 1980 548228465 548227753 0.000000e+00 1077
7 TraesCS4A01G050600 chr1D 97.981 1981 33 2 1 1980 156776732 156778706 0.000000e+00 3430
8 TraesCS4A01G050600 chr3A 97.794 1360 27 1 624 1980 662139618 662140977 0.000000e+00 2342
9 TraesCS4A01G050600 chr3A 96.508 630 19 2 1 629 662124525 662125152 0.000000e+00 1038
10 TraesCS4A01G050600 chr6A 96.891 1351 23 4 646 1980 99978139 99976792 0.000000e+00 2244
11 TraesCS4A01G050600 chr6A 95.380 606 22 4 1 602 100058479 100057876 0.000000e+00 959
12 TraesCS4A01G050600 chr6A 95.575 113 5 0 1 113 100058692 100058580 5.770000e-42 182
13 TraesCS4A01G050600 chr5A 98.778 1227 15 0 754 1980 299774058 299772832 0.000000e+00 2183
14 TraesCS4A01G050600 chr5A 97.386 765 19 1 1 764 299775012 299774248 0.000000e+00 1301
15 TraesCS4A01G050600 chr2B 93.903 1181 66 3 1 1176 493241611 493242790 0.000000e+00 1777
16 TraesCS4A01G050600 chr2B 94.274 716 29 5 1252 1965 493242792 493243497 0.000000e+00 1085
17 TraesCS4A01G050600 chr4B 89.221 1438 102 23 1 1403 570343834 570345253 0.000000e+00 1748
18 TraesCS4A01G050600 chr7A 96.937 653 17 2 1976 2626 200007642 200008293 0.000000e+00 1092
19 TraesCS4A01G050600 chr7A 97.674 43 1 0 1974 2016 3968235 3968277 1.010000e-09 75
20 TraesCS4A01G050600 chr5D 96.472 652 21 1 1977 2626 34273869 34273218 0.000000e+00 1075
21 TraesCS4A01G050600 chr2D 96.456 649 21 1 1977 2623 433216735 433217383 0.000000e+00 1070
22 TraesCS4A01G050600 chr2A 94.225 658 25 3 1977 2626 554016853 554016201 0.000000e+00 992
23 TraesCS4A01G050600 chr3D 86.806 288 35 2 1429 1715 350130046 350130331 4.220000e-83 318
24 TraesCS4A01G050600 chr5B 86.689 293 30 7 1429 1719 468630265 468629980 1.520000e-82 316


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G050600 chr4A 41895263 41897888 2625 False 4850.0 4850 100.0000 1 2626 1 chr4A.!!$F1 2625
1 TraesCS4A01G050600 chr4A 725868809 725870613 1804 True 868.0 1624 93.0910 1 1965 3 chr4A.!!$R1 1964
2 TraesCS4A01G050600 chr1A 452024015 452026618 2603 True 4558.0 4558 98.1350 1 2626 1 chr1A.!!$R1 2625
3 TraesCS4A01G050600 chr1A 548227753 548229640 1887 True 1435.5 1794 94.0010 6 1980 2 chr1A.!!$R2 1974
4 TraesCS4A01G050600 chr1D 156776732 156778706 1974 False 3430.0 3430 97.9810 1 1980 1 chr1D.!!$F1 1979
5 TraesCS4A01G050600 chr3A 662139618 662140977 1359 False 2342.0 2342 97.7940 624 1980 1 chr3A.!!$F2 1356
6 TraesCS4A01G050600 chr3A 662124525 662125152 627 False 1038.0 1038 96.5080 1 629 1 chr3A.!!$F1 628
7 TraesCS4A01G050600 chr6A 99976792 99978139 1347 True 2244.0 2244 96.8910 646 1980 1 chr6A.!!$R1 1334
8 TraesCS4A01G050600 chr6A 100057876 100058692 816 True 570.5 959 95.4775 1 602 2 chr6A.!!$R2 601
9 TraesCS4A01G050600 chr5A 299772832 299775012 2180 True 1742.0 2183 98.0820 1 1980 2 chr5A.!!$R1 1979
10 TraesCS4A01G050600 chr2B 493241611 493243497 1886 False 1431.0 1777 94.0885 1 1965 2 chr2B.!!$F1 1964
11 TraesCS4A01G050600 chr4B 570343834 570345253 1419 False 1748.0 1748 89.2210 1 1403 1 chr4B.!!$F1 1402
12 TraesCS4A01G050600 chr7A 200007642 200008293 651 False 1092.0 1092 96.9370 1976 2626 1 chr7A.!!$F2 650
13 TraesCS4A01G050600 chr5D 34273218 34273869 651 True 1075.0 1075 96.4720 1977 2626 1 chr5D.!!$R1 649
14 TraesCS4A01G050600 chr2D 433216735 433217383 648 False 1070.0 1070 96.4560 1977 2623 1 chr2D.!!$F1 646
15 TraesCS4A01G050600 chr2A 554016201 554016853 652 True 992.0 992 94.2250 1977 2626 1 chr2A.!!$R1 649

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
96 310 1.374125 CACAGGTTCGATGTGGCGA 60.374 57.895 9.34 0.0 43.47 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1970 2445 3.379372 GCCTTGCTGATCTGAAAATAGCA 59.621 43.478 3.42 0.45 42.09 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 310 1.374125 CACAGGTTCGATGTGGCGA 60.374 57.895 9.34 0.0 43.47 5.54
107 322 3.124466 TCGATGTGGCGATTGTTAACTTG 59.876 43.478 7.22 0.0 35.01 3.16
170 385 2.304761 TGGTCTCGCACCTCCTTATTTT 59.695 45.455 5.13 0.0 46.98 1.82
357 601 3.682921 GAGACGACGAAGAGATTGGTAC 58.317 50.000 0.00 0.0 0.00 3.34
715 967 8.180165 AGAGTATACCTCCATAATTCTCCATCA 58.820 37.037 0.00 0.0 41.47 3.07
1801 2272 9.793252 CAAACCTTATCATTTCCATTTGTAGAG 57.207 33.333 0.00 0.0 0.00 2.43
1834 2309 0.615331 TGAGGGATCAGTTGGCACTC 59.385 55.000 0.00 0.0 0.00 3.51
1965 2440 5.133221 ACAATCAACTAAGCTCCAACAACT 58.867 37.500 0.00 0.0 0.00 3.16
1966 2441 5.594317 ACAATCAACTAAGCTCCAACAACTT 59.406 36.000 0.00 0.0 0.00 2.66
1967 2442 6.770785 ACAATCAACTAAGCTCCAACAACTTA 59.229 34.615 0.00 0.0 0.00 2.24
1968 2443 7.448469 ACAATCAACTAAGCTCCAACAACTTAT 59.552 33.333 0.00 0.0 0.00 1.73
1969 2444 7.617041 ATCAACTAAGCTCCAACAACTTATC 57.383 36.000 0.00 0.0 0.00 1.75
1970 2445 6.769512 TCAACTAAGCTCCAACAACTTATCT 58.230 36.000 0.00 0.0 0.00 1.98
1971 2446 6.650807 TCAACTAAGCTCCAACAACTTATCTG 59.349 38.462 0.00 0.0 0.00 2.90
1972 2447 4.938226 ACTAAGCTCCAACAACTTATCTGC 59.062 41.667 0.00 0.0 0.00 4.26
1973 2448 3.710209 AGCTCCAACAACTTATCTGCT 57.290 42.857 0.00 0.0 0.00 4.24
1974 2449 4.826274 AGCTCCAACAACTTATCTGCTA 57.174 40.909 0.00 0.0 0.00 3.49
1975 2450 5.365021 AGCTCCAACAACTTATCTGCTAT 57.635 39.130 0.00 0.0 0.00 2.97
2165 2640 2.159517 CCGGCAAGTCAGATAAAAGTGC 60.160 50.000 0.00 0.0 0.00 4.40
2194 2669 9.440773 TCTGATACGAGAAAGTACTACTGTTTA 57.559 33.333 0.00 0.0 0.00 2.01
2556 3039 4.275443 CACCAATTCACCATTGTTTTTGGG 59.725 41.667 0.00 0.0 40.87 4.12
2583 3066 7.394641 TGACCCAATTTATGTAAGCATGTACAA 59.605 33.333 0.00 0.0 37.52 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 2.126882 TGCCTGGCTAACTATGGACAT 58.873 47.619 21.03 0.00 0.00 3.06
107 322 6.144078 ACTACCATTTTTCACAGTTGGAAC 57.856 37.500 0.00 0.00 0.00 3.62
357 601 5.639082 TCATATTCTGCCTACACATTATGCG 59.361 40.000 0.00 0.00 0.00 4.73
1968 2443 4.880120 CCTTGCTGATCTGAAAATAGCAGA 59.120 41.667 3.42 0.00 44.19 4.26
1969 2444 4.497674 GCCTTGCTGATCTGAAAATAGCAG 60.498 45.833 3.42 0.00 44.19 4.24
1970 2445 3.379372 GCCTTGCTGATCTGAAAATAGCA 59.621 43.478 3.42 0.45 42.09 3.49
1971 2446 3.379372 TGCCTTGCTGATCTGAAAATAGC 59.621 43.478 3.42 3.68 35.06 2.97
1972 2447 5.356190 TCTTGCCTTGCTGATCTGAAAATAG 59.644 40.000 3.42 0.00 0.00 1.73
1973 2448 5.255687 TCTTGCCTTGCTGATCTGAAAATA 58.744 37.500 3.42 0.00 0.00 1.40
1974 2449 4.084287 TCTTGCCTTGCTGATCTGAAAAT 58.916 39.130 3.42 0.00 0.00 1.82
1975 2450 3.489355 TCTTGCCTTGCTGATCTGAAAA 58.511 40.909 3.42 0.00 0.00 2.29
2062 2537 8.801715 ACAACATTAAGAAACATAAAGTGCAG 57.198 30.769 0.00 0.00 0.00 4.41
2165 2640 7.012515 ACAGTAGTACTTTCTCGTATCAGATGG 59.987 40.741 0.00 0.00 0.00 3.51
2556 3039 6.207691 ACATGCTTACATAAATTGGGTCAC 57.792 37.500 0.00 0.00 33.67 3.67
2583 3066 7.496591 TCTGGTTTGTGTTTCGTAGTCTAATTT 59.503 33.333 0.00 0.00 0.00 1.82
2593 3076 6.657541 ACCAATATATCTGGTTTGTGTTTCGT 59.342 34.615 11.56 0.00 45.13 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.