Multiple sequence alignment - TraesCS4A01G026500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G026500 chr4A 100.000 2633 0 0 1 2633 18145105 18147737 0 4863
1 TraesCS4A01G026500 chr4A 97.572 2636 51 6 1 2633 510024736 510022111 0 4501
2 TraesCS4A01G026500 chr3A 98.293 2636 37 4 1 2633 65475710 65473080 0 4612
3 TraesCS4A01G026500 chr5A 98.141 2636 46 2 1 2633 610467863 610470498 0 4593
4 TraesCS4A01G026500 chr2A 98.142 2637 44 4 1 2633 607507571 607504936 0 4593
5 TraesCS4A01G026500 chr2A 97.989 2636 50 2 1 2633 770443937 770446572 0 4571
6 TraesCS4A01G026500 chr7A 98.103 2636 45 4 1 2633 573665738 573663105 0 4586
7 TraesCS4A01G026500 chr6A 97.762 2636 50 4 1 2633 443531579 443528950 0 4532
8 TraesCS4A01G026500 chr6A 97.763 2637 42 7 1 2633 592581539 592584162 0 4527
9 TraesCS4A01G026500 chr5B 95.176 2239 89 15 130 2360 273588901 273591128 0 3518


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G026500 chr4A 18145105 18147737 2632 False 4863 4863 100.000 1 2633 1 chr4A.!!$F1 2632
1 TraesCS4A01G026500 chr4A 510022111 510024736 2625 True 4501 4501 97.572 1 2633 1 chr4A.!!$R1 2632
2 TraesCS4A01G026500 chr3A 65473080 65475710 2630 True 4612 4612 98.293 1 2633 1 chr3A.!!$R1 2632
3 TraesCS4A01G026500 chr5A 610467863 610470498 2635 False 4593 4593 98.141 1 2633 1 chr5A.!!$F1 2632
4 TraesCS4A01G026500 chr2A 607504936 607507571 2635 True 4593 4593 98.142 1 2633 1 chr2A.!!$R1 2632
5 TraesCS4A01G026500 chr2A 770443937 770446572 2635 False 4571 4571 97.989 1 2633 1 chr2A.!!$F1 2632
6 TraesCS4A01G026500 chr7A 573663105 573665738 2633 True 4586 4586 98.103 1 2633 1 chr7A.!!$R1 2632
7 TraesCS4A01G026500 chr6A 443528950 443531579 2629 True 4532 4532 97.762 1 2633 1 chr6A.!!$R1 2632
8 TraesCS4A01G026500 chr6A 592581539 592584162 2623 False 4527 4527 97.763 1 2633 1 chr6A.!!$F1 2632
9 TraesCS4A01G026500 chr5B 273588901 273591128 2227 False 3518 3518 95.176 130 2360 1 chr5B.!!$F1 2230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
563 566 1.457346 CTTGGCTTTGAGCAGTAGGG 58.543 55.0 2.04 0.0 44.75 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2030 2039 0.040058 TTCCACCGCTACCTCCAGTA 59.96 55.0 0.0 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
503 505 3.827008 TCATCATACTCACCCTTGCTC 57.173 47.619 0.00 0.00 0.00 4.26
563 566 1.457346 CTTGGCTTTGAGCAGTAGGG 58.543 55.000 2.04 0.00 44.75 3.53
573 576 3.014085 GCAGTAGGGGTAGCACGCA 62.014 63.158 0.00 0.00 32.03 5.24
926 931 6.054941 ACGTGGCTCATTTGATTATATGTCA 58.945 36.000 0.00 0.00 0.00 3.58
1361 1366 0.955919 GCACAACTCCAGCAGTACCC 60.956 60.000 0.00 0.00 32.30 3.69
1485 1490 1.532794 CTGGATCGAGGAGGAGGGG 60.533 68.421 0.00 0.00 0.00 4.79
1636 1641 5.906772 TGAGAAAGGAAAGAACTAAGGGT 57.093 39.130 0.00 0.00 0.00 4.34
1640 1645 4.790718 AAGGAAAGAACTAAGGGTGTGT 57.209 40.909 0.00 0.00 0.00 3.72
1692 1697 3.319137 TGAGTGGTCGTACGTACTAGT 57.681 47.619 22.55 12.31 0.00 2.57
2030 2039 7.451731 TCATGGAGATTTTTCTACTACCCAT 57.548 36.000 0.00 0.00 32.63 4.00
2031 2040 8.561536 TCATGGAGATTTTTCTACTACCCATA 57.438 34.615 0.00 0.00 31.40 2.74
2049 2058 0.040058 TACTGGAGGTAGCGGTGGAA 59.960 55.000 0.00 0.00 0.00 3.53
2607 2617 5.957842 TGAAAATGATGAAGTAAAGGCGT 57.042 34.783 0.00 0.00 0.00 5.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 1.354506 GGGTACTCCGACATCGACG 59.645 63.158 2.09 0.00 43.02 5.12
503 505 6.205270 ACTTTGGGCTGCAAAAATAGAAATTG 59.795 34.615 0.50 0.00 0.00 2.32
563 566 4.814294 CTCCCGGTGCGTGCTACC 62.814 72.222 0.00 0.00 34.81 3.18
573 576 3.268595 ACTTCAATTTATTCCCTCCCGGT 59.731 43.478 0.00 0.00 0.00 5.28
1361 1366 2.231478 TCTTGCTTCCTACGAACCTCAG 59.769 50.000 0.00 0.00 0.00 3.35
1485 1490 1.597742 TCAGCTTCTTGGTCTTGTGC 58.402 50.000 0.00 0.00 0.00 4.57
1636 1641 4.202121 GCCTGCTAGCTAGTATGTTACACA 60.202 45.833 21.62 7.11 0.00 3.72
1640 1645 3.483421 TCGCCTGCTAGCTAGTATGTTA 58.517 45.455 21.62 4.85 0.00 2.41
1692 1697 7.466746 AGCTCTGCCACTTCATTTATTTAAA 57.533 32.000 0.00 0.00 0.00 1.52
1924 1932 4.377897 CACTCTTCATAGCATGCATCAGA 58.622 43.478 21.98 11.98 0.00 3.27
2030 2039 0.040058 TTCCACCGCTACCTCCAGTA 59.960 55.000 0.00 0.00 0.00 2.74
2031 2040 1.229082 TTCCACCGCTACCTCCAGT 60.229 57.895 0.00 0.00 0.00 4.00
2049 2058 1.048601 TCTTCTGCGGTCCTTTGAGT 58.951 50.000 0.00 0.00 0.00 3.41
2607 2617 4.379174 GCCTTGAGCGAACCTTCA 57.621 55.556 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.