Multiple sequence alignment - TraesCS4A01G024700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G024700 chr4A 100.000 2177 0 0 1 2177 17099287 17097111 0 4021
1 TraesCS4A01G024700 chr6D 97.659 2179 49 2 1 2177 389254923 389252745 0 3740
2 TraesCS4A01G024700 chr5D 97.614 2179 49 3 1 2177 503238780 503236603 0 3733
3 TraesCS4A01G024700 chr5D 97.649 2169 48 3 11 2177 503243019 503240852 0 3720
4 TraesCS4A01G024700 chr3A 97.568 2179 50 3 1 2177 66007378 66009555 0 3727
5 TraesCS4A01G024700 chr3A 97.246 2179 58 2 1 2177 672899767 672901945 0 3690
6 TraesCS4A01G024700 chrUn 97.339 2180 52 4 1 2177 216508364 216510540 0 3699
7 TraesCS4A01G024700 chr3B 97.155 2179 59 3 1 2177 201537274 201535097 0 3677
8 TraesCS4A01G024700 chr2A 96.925 2179 65 2 1 2177 335845066 335842888 0 3651
9 TraesCS4A01G024700 chr1B 96.743 2180 61 5 1 2177 633743659 633745831 0 3624


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G024700 chr4A 17097111 17099287 2176 True 4021.0 4021 100.0000 1 2177 1 chr4A.!!$R1 2176
1 TraesCS4A01G024700 chr6D 389252745 389254923 2178 True 3740.0 3740 97.6590 1 2177 1 chr6D.!!$R1 2176
2 TraesCS4A01G024700 chr5D 503236603 503243019 6416 True 3726.5 3733 97.6315 1 2177 2 chr5D.!!$R1 2176
3 TraesCS4A01G024700 chr3A 66007378 66009555 2177 False 3727.0 3727 97.5680 1 2177 1 chr3A.!!$F1 2176
4 TraesCS4A01G024700 chr3A 672899767 672901945 2178 False 3690.0 3690 97.2460 1 2177 1 chr3A.!!$F2 2176
5 TraesCS4A01G024700 chrUn 216508364 216510540 2176 False 3699.0 3699 97.3390 1 2177 1 chrUn.!!$F1 2176
6 TraesCS4A01G024700 chr3B 201535097 201537274 2177 True 3677.0 3677 97.1550 1 2177 1 chr3B.!!$R1 2176
7 TraesCS4A01G024700 chr2A 335842888 335845066 2178 True 3651.0 3651 96.9250 1 2177 1 chr2A.!!$R1 2176
8 TraesCS4A01G024700 chr1B 633743659 633745831 2172 False 3624.0 3624 96.7430 1 2177 1 chr1B.!!$F1 2176

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
461 462 0.029474 TATCCCTTCCCCGTCCCATT 60.029 55.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1428 5679 0.538118 AAGACCCGCGGTAGCAATAA 59.462 50.0 26.12 0.0 45.49 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 64 0.608856 TACTCACCCGTTCGCCACTA 60.609 55.000 0.00 0.0 0.00 2.74
94 95 0.250124 TCCCGTTCGACTTGCATGTT 60.250 50.000 6.70 0.0 0.00 2.71
121 122 1.227147 GCCGCCAGCGTTCATACTA 60.227 57.895 11.55 0.0 37.81 1.82
328 329 4.821532 AGCCTCTTATCCATTCCCATTT 57.178 40.909 0.00 0.0 0.00 2.32
329 330 5.148225 AGCCTCTTATCCATTCCCATTTT 57.852 39.130 0.00 0.0 0.00 1.82
461 462 0.029474 TATCCCTTCCCCGTCCCATT 60.029 55.000 0.00 0.0 0.00 3.16
464 465 1.688811 CCTTCCCCGTCCCATTGAA 59.311 57.895 0.00 0.0 0.00 2.69
523 524 3.252554 ACTCAAGGTCACTCTTCCTCT 57.747 47.619 0.00 0.0 33.09 3.69
618 619 5.531122 TCGAAAGTAGGATTGACTATGGG 57.469 43.478 0.00 0.0 0.00 4.00
651 652 6.993786 TCGCACATGGTTTCATAAAATCTA 57.006 33.333 0.00 0.0 31.33 1.98
797 5047 4.474651 ACCAAGTCAAGATGATATGGGTCA 59.525 41.667 14.76 0.0 38.50 4.02
965 5215 9.533831 AGGAACACATACAAGAAAAAGGATAAT 57.466 29.630 0.00 0.0 0.00 1.28
1041 5291 2.225382 TCCATGTCCTACCGAGACAA 57.775 50.000 0.00 0.0 46.67 3.18
1130 5380 4.420206 TCAGATCGATATGAGGACCCAAT 58.580 43.478 18.40 0.0 0.00 3.16
1180 5430 2.871096 ATTTGAAGCGGGTTGACCTA 57.129 45.000 0.00 0.0 36.97 3.08
1232 5482 0.911525 CTGAGCCCCCTTTCTCCTCA 60.912 60.000 0.00 0.0 0.00 3.86
1239 5489 0.247736 CCCTTTCTCCTCAGTCCACG 59.752 60.000 0.00 0.0 0.00 4.94
1240 5490 1.257743 CCTTTCTCCTCAGTCCACGA 58.742 55.000 0.00 0.0 0.00 4.35
1305 5555 3.107402 AGAACTCACAGAGCTGGGATA 57.893 47.619 2.45 0.0 42.88 2.59
1428 5679 6.536447 TCTTTTCTGTATACTTTCCCCGTTT 58.464 36.000 4.17 0.0 0.00 3.60
1706 5957 4.579869 AGGTTCTCTATTGATGCAAACGT 58.420 39.130 0.00 0.0 0.00 3.99
1801 6053 6.969993 AATAAGTCGAAGATAGAAGAGCCT 57.030 37.500 0.00 0.0 40.67 4.58
2048 6300 1.627297 GGAGTGGAAGAAGGGCGGAT 61.627 60.000 0.00 0.0 0.00 4.18
2127 6380 5.479375 AGGTGAAAATCTCTGTACGGTTCTA 59.521 40.000 0.64 0.0 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 64 1.808891 CGAACGGGAAGTGGTGTTTCT 60.809 52.381 0.00 0.00 0.00 2.52
94 95 2.884367 GCTGGCGGCATGCTTAAA 59.116 55.556 18.92 0.49 45.43 1.52
118 119 2.691011 GAGAGTTCGATCCTGGCTTAGT 59.309 50.000 0.00 0.00 0.00 2.24
121 122 0.827368 GGAGAGTTCGATCCTGGCTT 59.173 55.000 0.00 0.00 32.51 4.35
179 180 6.204688 ACAATTTCGAATCTGCTTTGTCTACA 59.795 34.615 0.00 0.00 0.00 2.74
328 329 0.178926 TTACTCCCCCACCACGAGAA 60.179 55.000 0.00 0.00 0.00 2.87
329 330 0.613853 CTTACTCCCCCACCACGAGA 60.614 60.000 0.00 0.00 0.00 4.04
464 465 7.610305 TGCCTTAGGATTCGTTAATTCTCTTTT 59.390 33.333 0.69 0.00 32.81 2.27
523 524 0.398696 TAGTGCGGAAAGAAAGCCCA 59.601 50.000 0.00 0.00 0.00 5.36
679 680 7.000472 TGAACAAGATCTTCTTCATGGAAACT 59.000 34.615 18.79 0.00 33.78 2.66
797 5047 2.034221 GGCGCAAGAAGAAGGGGT 59.966 61.111 10.83 0.00 43.02 4.95
885 5135 2.558359 CTCAAGAAAAGGGCGTGGAAAT 59.442 45.455 0.00 0.00 0.00 2.17
928 5178 9.256228 TCTTGTATGTGTTCCTAAGAGAAGTAT 57.744 33.333 0.00 0.00 0.00 2.12
1041 5291 7.148000 GGCAAGAGGATAGCAAGTTCTAAATTT 60.148 37.037 0.00 0.00 0.00 1.82
1130 5380 2.168936 GGATTCTGGCAATGCAATGGAA 59.831 45.455 7.79 5.78 0.00 3.53
1180 5430 4.558226 TTGTACCATGAGAGAAGCACAT 57.442 40.909 0.00 0.00 0.00 3.21
1403 5654 6.309389 ACGGGGAAAGTATACAGAAAAGAT 57.691 37.500 5.50 0.00 0.00 2.40
1428 5679 0.538118 AAGACCCGCGGTAGCAATAA 59.462 50.000 26.12 0.00 45.49 1.40
1706 5957 6.217900 CCTCTATCCCTATCCTCTAGGTACAA 59.782 46.154 0.00 0.00 36.34 2.41
1801 6053 9.312904 AGTTTCCATTTCTTCATTTGGAATCTA 57.687 29.630 10.77 0.00 45.14 1.98
2048 6300 3.415212 TCCTTTTCCTCGTTCGAGAGTA 58.585 45.455 21.39 5.93 36.56 2.59
2127 6380 4.436079 AGTCACCCTTACTGTCCCTTTAT 58.564 43.478 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.