Multiple sequence alignment - TraesCS4A01G015000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4A01G015000 chr4A 100.000 2513 0 0 1 2513 9466889 9469401 0 4641
1 TraesCS4A01G015000 chr1A 96.918 2498 68 7 2 2495 517446948 517444456 0 4178
2 TraesCS4A01G015000 chr1A 96.273 2495 72 14 1 2485 257591378 257588895 0 4072
3 TraesCS4A01G015000 chr1A 96.138 2486 78 11 1 2485 582806012 582808480 0 4043
4 TraesCS4A01G015000 chr6A 96.744 2488 68 11 1 2485 468224302 468226779 0 4133
5 TraesCS4A01G015000 chr6A 96.474 2496 72 9 2 2495 357526636 357524155 0 4108
6 TraesCS4A01G015000 chr6A 96.035 2497 86 10 2 2495 251355322 251352836 0 4050
7 TraesCS4A01G015000 chr7A 96.394 2496 77 9 2 2495 165281048 165283532 0 4098
8 TraesCS4A01G015000 chr5A 96.262 2488 77 13 2 2485 580225350 580222875 0 4065
9 TraesCS4A01G015000 chr2A 96.115 2497 81 10 2 2495 596742731 596740248 0 4060


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4A01G015000 chr4A 9466889 9469401 2512 False 4641 4641 100.000 1 2513 1 chr4A.!!$F1 2512
1 TraesCS4A01G015000 chr1A 517444456 517446948 2492 True 4178 4178 96.918 2 2495 1 chr1A.!!$R2 2493
2 TraesCS4A01G015000 chr1A 257588895 257591378 2483 True 4072 4072 96.273 1 2485 1 chr1A.!!$R1 2484
3 TraesCS4A01G015000 chr1A 582806012 582808480 2468 False 4043 4043 96.138 1 2485 1 chr1A.!!$F1 2484
4 TraesCS4A01G015000 chr6A 468224302 468226779 2477 False 4133 4133 96.744 1 2485 1 chr6A.!!$F1 2484
5 TraesCS4A01G015000 chr6A 357524155 357526636 2481 True 4108 4108 96.474 2 2495 1 chr6A.!!$R2 2493
6 TraesCS4A01G015000 chr6A 251352836 251355322 2486 True 4050 4050 96.035 2 2495 1 chr6A.!!$R1 2493
7 TraesCS4A01G015000 chr7A 165281048 165283532 2484 False 4098 4098 96.394 2 2495 1 chr7A.!!$F1 2493
8 TraesCS4A01G015000 chr5A 580222875 580225350 2475 True 4065 4065 96.262 2 2485 1 chr5A.!!$R1 2483
9 TraesCS4A01G015000 chr2A 596740248 596742731 2483 True 4060 4060 96.115 2 2495 1 chr2A.!!$R1 2493

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
853 869 0.684535 TCCGACAGACAAAGGCATCA 59.315 50.0 0.0 0.0 0.0 3.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1703 1720 2.02893 CGAGCTAGGGTATGATCCAACC 60.029 54.545 5.23 5.23 34.85 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 203 5.122396 ACGAACTCTGAAAATGTTCATAGGC 59.878 40.000 13.86 6.18 42.85 3.93
836 852 2.046292 CCCTTCTCCTCTTCTCCATCC 58.954 57.143 0.00 0.00 0.00 3.51
853 869 0.684535 TCCGACAGACAAAGGCATCA 59.315 50.000 0.00 0.00 0.00 3.07
883 899 4.821805 TCGAGCAATTCCTCTGTTTCTTTT 59.178 37.500 0.00 0.00 0.00 2.27
913 929 4.399219 TCTCGTTCTTCTTCCTCTTGAGA 58.601 43.478 0.00 0.00 0.00 3.27
1279 1295 1.115326 GCTTCAAGGGTTGGGCTTGT 61.115 55.000 0.00 0.00 0.00 3.16
1556 1573 4.769488 TGCCATTGTTTAGCAATCCAAGTA 59.231 37.500 0.00 0.00 45.33 2.24
1647 1664 4.457949 AGTTTTGACACTTTCAGTTTCGGT 59.542 37.500 0.00 0.00 34.94 4.69
1703 1720 7.787725 ATTTTGTTAGCTAATAACCTCGAGG 57.212 36.000 30.11 30.11 42.74 4.63
2154 2175 8.940924 GTTAAAACTACACTTTTGACTAAAGCG 58.059 33.333 8.98 3.05 45.87 4.68
2495 2516 6.188407 CCTTACATAGATAGGGTAGCTAGCA 58.812 44.000 23.49 5.36 29.21 3.49
2496 2517 6.095720 CCTTACATAGATAGGGTAGCTAGCAC 59.904 46.154 23.49 12.66 29.21 4.40
2497 2518 5.263872 ACATAGATAGGGTAGCTAGCACT 57.736 43.478 23.49 18.82 29.21 4.40
2498 2519 5.013547 ACATAGATAGGGTAGCTAGCACTG 58.986 45.833 23.49 11.57 29.21 3.66
2499 2520 2.883026 AGATAGGGTAGCTAGCACTGG 58.117 52.381 23.49 0.00 0.00 4.00
2500 2521 2.178106 AGATAGGGTAGCTAGCACTGGT 59.822 50.000 23.49 11.44 0.00 4.00
2501 2522 3.398292 AGATAGGGTAGCTAGCACTGGTA 59.602 47.826 23.49 7.73 0.00 3.25
2502 2523 2.074729 AGGGTAGCTAGCACTGGTAG 57.925 55.000 23.49 10.43 36.79 3.18
2503 2524 1.569548 AGGGTAGCTAGCACTGGTAGA 59.430 52.381 23.49 0.00 35.90 2.59
2504 2525 2.024273 AGGGTAGCTAGCACTGGTAGAA 60.024 50.000 23.49 3.58 35.90 2.10
2505 2526 2.764572 GGGTAGCTAGCACTGGTAGAAA 59.235 50.000 23.49 3.26 35.90 2.52
2506 2527 3.197116 GGGTAGCTAGCACTGGTAGAAAA 59.803 47.826 23.49 1.03 35.90 2.29
2507 2528 4.323257 GGGTAGCTAGCACTGGTAGAAAAA 60.323 45.833 23.49 0.00 35.90 1.94
2508 2529 4.870991 GGTAGCTAGCACTGGTAGAAAAAG 59.129 45.833 18.83 0.00 35.90 2.27
2509 2530 3.944087 AGCTAGCACTGGTAGAAAAAGG 58.056 45.455 18.83 0.00 35.90 3.11
2510 2531 3.010420 GCTAGCACTGGTAGAAAAAGGG 58.990 50.000 17.71 0.00 35.90 3.95
2511 2532 1.911057 AGCACTGGTAGAAAAAGGGC 58.089 50.000 0.00 0.00 40.78 5.19
2512 2533 0.888619 GCACTGGTAGAAAAAGGGCC 59.111 55.000 0.00 0.00 34.14 5.80
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 148 5.321927 GGAGAGATGGTTTAGGGTTTGAAA 58.678 41.667 0.00 0.00 0.00 2.69
143 149 4.263771 GGGAGAGATGGTTTAGGGTTTGAA 60.264 45.833 0.00 0.00 0.00 2.69
158 164 6.001460 CAGAGTTCGTAGAATAGGGAGAGAT 58.999 44.000 0.00 0.00 45.90 2.75
197 203 4.867047 AGTCTTCACACAAATGAGCTATCG 59.133 41.667 0.00 0.00 0.00 2.92
583 598 1.367840 GCGCTTGGTAGGATCCGAT 59.632 57.895 5.98 0.00 0.00 4.18
836 852 1.135859 GCTTGATGCCTTTGTCTGTCG 60.136 52.381 0.00 0.00 35.15 4.35
853 869 2.170187 AGAGGAATTGCTCGATCTGCTT 59.830 45.455 19.75 0.00 0.00 3.91
883 899 3.195825 GGAAGAAGAACGAGAAGATGGGA 59.804 47.826 0.00 0.00 0.00 4.37
1279 1295 0.106719 GCATTCCCCCTCGAATCCAA 60.107 55.000 0.00 0.00 29.85 3.53
1351 1367 2.195389 CCGTCGGGTATTCTGGACA 58.805 57.895 2.34 0.00 0.00 4.02
1556 1573 8.891671 AACAAAGTTGCATTTGAGATAAACAT 57.108 26.923 17.47 0.00 41.71 2.71
1647 1664 6.880484 TCACTGAACTGGTAGTTGTTTTCTA 58.120 36.000 0.00 0.00 38.80 2.10
1703 1720 2.028930 CGAGCTAGGGTATGATCCAACC 60.029 54.545 5.23 5.23 34.85 3.77
2399 2420 7.711339 CCTAGCAACCCTATCTAAGTTAAGTTG 59.289 40.741 5.77 0.00 37.12 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.