Multiple sequence alignment - TraesCS3D01G544600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G544600 chr3D 100.000 2345 0 0 1 2345 614097217 614099561 0.000000e+00 4331.0
1 TraesCS3D01G544600 chr6D 97.835 2263 35 9 94 2345 137150424 137152683 0.000000e+00 3895.0
2 TraesCS3D01G544600 chr6D 91.729 133 5 1 2213 2345 440673432 440673306 1.850000e-41 180.0
3 TraesCS3D01G544600 chr6D 96.842 95 3 0 1 95 137150301 137150395 2.410000e-35 159.0
4 TraesCS3D01G544600 chrUn 100.000 384 0 0 924 1307 480895808 480895425 0.000000e+00 710.0
5 TraesCS3D01G544600 chr5B 80.122 654 110 12 780 1429 492801534 492800897 9.810000e-129 470.0
6 TraesCS3D01G544600 chr5B 94.444 36 1 1 1433 1468 492800848 492800814 1.000000e-03 54.7
7 TraesCS3D01G544600 chr3B 79.066 578 107 9 780 1353 59729842 59729275 3.660000e-103 385.0
8 TraesCS3D01G544600 chr7D 82.933 416 49 12 1437 1830 6079961 6079546 2.870000e-94 355.0
9 TraesCS3D01G544600 chr7D 82.677 127 15 3 1829 1955 6079000 6078881 3.190000e-19 106.0
10 TraesCS3D01G544600 chr7D 100.000 32 0 0 1437 1468 34968394 34968425 2.520000e-05 60.2
11 TraesCS3D01G544600 chr7A 88.797 241 21 2 1587 1827 719591313 719591547 8.200000e-75 291.0
12 TraesCS3D01G544600 chr7A 89.796 147 12 2 2066 2211 719592208 719592352 3.980000e-43 185.0
13 TraesCS3D01G544600 chr7A 95.238 105 5 0 2241 2345 41465365 41465469 1.440000e-37 167.0
14 TraesCS3D01G544600 chr7A 90.265 113 11 0 1829 1941 719592058 719592170 5.220000e-32 148.0
15 TraesCS3D01G544600 chr7A 94.805 77 4 0 19 95 719591015 719591091 1.140000e-23 121.0
16 TraesCS3D01G544600 chr4A 91.729 133 5 1 2213 2345 658381511 658381385 1.850000e-41 180.0
17 TraesCS3D01G544600 chr7B 95.413 109 5 0 2237 2345 228800698 228800590 8.610000e-40 174.0
18 TraesCS3D01G544600 chr7B 100.000 32 0 0 1437 1468 170527898 170527867 2.520000e-05 60.2
19 TraesCS3D01G544600 chr5D 90.226 133 7 1 2213 2345 27280849 27280723 4.010000e-38 169.0
20 TraesCS3D01G544600 chr2B 90.226 133 7 1 2213 2345 134341419 134341293 4.010000e-38 169.0
21 TraesCS3D01G544600 chr2A 95.238 105 5 0 2241 2345 756523886 756523782 1.440000e-37 167.0
22 TraesCS3D01G544600 chr2A 83.636 110 16 2 2103 2211 735605330 735605222 4.120000e-18 102.0
23 TraesCS3D01G544600 chr3A 88.722 133 9 1 2213 2345 662597910 662598036 8.680000e-35 158.0
24 TraesCS3D01G544600 chr4B 83.871 124 19 1 2088 2211 624039465 624039587 1.470000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G544600 chr3D 614097217 614099561 2344 False 4331.00 4331 100.0000 1 2345 1 chr3D.!!$F1 2344
1 TraesCS3D01G544600 chr6D 137150301 137152683 2382 False 2027.00 3895 97.3385 1 2345 2 chr6D.!!$F1 2344
2 TraesCS3D01G544600 chr5B 492800814 492801534 720 True 262.35 470 87.2830 780 1468 2 chr5B.!!$R1 688
3 TraesCS3D01G544600 chr3B 59729275 59729842 567 True 385.00 385 79.0660 780 1353 1 chr3B.!!$R1 573
4 TraesCS3D01G544600 chr7D 6078881 6079961 1080 True 230.50 355 82.8050 1437 1955 2 chr7D.!!$R1 518

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
63 64 3.084039 TGAAGGCATCACAAGACATTCC 58.916 45.455 0.0 0.0 31.5 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1429 1462 0.31179 ATGCAGCACAACCGTTTCAG 59.688 50.0 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 64 3.084039 TGAAGGCATCACAAGACATTCC 58.916 45.455 0.00 0.0 31.50 3.01
136 167 7.686438 ATACATAGTTGCTGTCAAATGTCAA 57.314 32.000 0.00 0.0 36.00 3.18
321 352 4.171878 GGCTCTTTTTAATAGGGAGGCT 57.828 45.455 0.00 0.0 43.26 4.58
606 637 3.117663 ACATGACAAGTGGTACAGGGTTT 60.118 43.478 0.00 0.0 41.80 3.27
719 750 8.709386 ACAATACTAAGTGTGATGATCAAGTC 57.291 34.615 0.00 0.0 31.50 3.01
775 806 6.590234 AAATTGACCATACCAACCTTTCTC 57.410 37.500 0.00 0.0 0.00 2.87
1311 1343 2.146073 AAATGCACAAGCTGCCGACC 62.146 55.000 0.00 0.0 46.51 4.79
1429 1462 5.697473 AGGAAAGAAAAGAAGCTAAGTGC 57.303 39.130 0.00 0.0 43.29 4.40
1525 1609 8.336806 CAGCATTTTTATTTGTGTGTTGTTGAT 58.663 29.630 0.00 0.0 0.00 2.57
1852 2498 1.584308 GACTACGATCAGCAAACTCGC 59.416 52.381 0.00 0.0 35.89 5.03
1951 2597 4.081586 ACGGAGAGAGGTGGAGTTAAATTC 60.082 45.833 0.00 0.0 0.00 2.17
1955 2601 6.154706 GGAGAGAGGTGGAGTTAAATTCAGTA 59.845 42.308 0.00 0.0 0.00 2.74
1956 2602 7.310485 GGAGAGAGGTGGAGTTAAATTCAGTAA 60.310 40.741 0.00 0.0 0.00 2.24
1957 2603 7.974504 AGAGAGGTGGAGTTAAATTCAGTAAA 58.025 34.615 0.00 0.0 0.00 2.01
2097 2743 0.854062 TTGTACAAACGTCGGCTTCG 59.146 50.000 5.64 0.0 0.00 3.79
2223 2886 4.636435 CCGTCGGTTGCCCACCTT 62.636 66.667 2.08 0.0 44.69 3.50
2239 2902 4.823989 CCCACCTTCTCCATTAAGCATAAG 59.176 45.833 0.00 0.0 0.00 1.73
2240 2903 4.276926 CCACCTTCTCCATTAAGCATAAGC 59.723 45.833 0.00 0.0 42.56 3.09
2241 2904 4.883585 CACCTTCTCCATTAAGCATAAGCA 59.116 41.667 0.00 0.0 45.49 3.91
2242 2905 5.533903 CACCTTCTCCATTAAGCATAAGCAT 59.466 40.000 0.00 0.0 45.49 3.79
2243 2906 6.712095 CACCTTCTCCATTAAGCATAAGCATA 59.288 38.462 0.00 0.0 45.49 3.14
2244 2907 7.229306 CACCTTCTCCATTAAGCATAAGCATAA 59.771 37.037 0.00 0.0 45.49 1.90
2257 2920 7.420800 AGCATAAGCATAACTAAGCAACATTC 58.579 34.615 0.00 0.0 45.49 2.67
2259 2922 7.377928 GCATAAGCATAACTAAGCAACATTCAG 59.622 37.037 0.00 0.0 41.58 3.02
2313 2976 5.700832 TCATGTGCTTCGTCAGATACTTTTT 59.299 36.000 0.00 0.0 0.00 1.94
2316 2979 5.177511 TGTGCTTCGTCAGATACTTTTTCAG 59.822 40.000 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 0.105964 TAAGTGGCGCAGAACACAGT 59.894 50.000 10.83 2.98 38.94 3.55
53 54 2.991250 ACCAGATTCCGGAATGTCTTG 58.009 47.619 33.84 22.62 0.00 3.02
63 64 7.657761 AGCAATAAGTATTCTAACCAGATTCCG 59.342 37.037 0.00 0.00 0.00 4.30
606 637 6.090129 GCTCAACAACTTCAACTTTGTACAA 58.910 36.000 3.59 3.59 34.82 2.41
775 806 3.633986 GGGAAATCAAGGACCTGCATTAG 59.366 47.826 0.00 0.00 0.00 1.73
1311 1343 2.860293 CTTGCTTGTACCGCACCG 59.140 61.111 6.45 0.00 37.07 4.94
1429 1462 0.311790 ATGCAGCACAACCGTTTCAG 59.688 50.000 0.00 0.00 0.00 3.02
1525 1609 2.202395 GCAAACAGCCAAGGAGCCA 61.202 57.895 0.00 0.00 37.23 4.75
2223 2886 9.494271 CTTAGTTATGCTTATGCTTAATGGAGA 57.506 33.333 10.78 0.00 39.73 3.71
2239 2902 8.693542 AAATTCTGAATGTTGCTTAGTTATGC 57.306 30.769 3.22 0.00 0.00 3.14
2257 2920 5.415701 ACAGTGGCCATGTAACTAAATTCTG 59.584 40.000 9.72 9.25 0.00 3.02
2259 2922 5.393027 CCACAGTGGCCATGTAACTAAATTC 60.393 44.000 9.72 0.00 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.