Multiple sequence alignment - TraesCS3D01G544200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G544200 chr3D 100.000 2384 0 0 1 2384 613867370 613869753 0 4403
1 TraesCS3D01G544200 chr3D 98.545 1718 22 3 1 1716 84530776 84532492 0 3031
2 TraesCS3D01G544200 chr3D 98.487 1718 24 2 1 1716 54664379 54662662 0 3027
3 TraesCS3D01G544200 chr3D 98.370 1718 26 2 1 1716 546357511 546355794 0 3016
4 TraesCS3D01G544200 chr3D 98.960 673 5 2 1713 2384 560165455 560164784 0 1203
5 TraesCS3D01G544200 chr2D 98.544 1717 24 1 1 1716 559267716 559269432 0 3031
6 TraesCS3D01G544200 chrUn 98.487 1718 23 3 1 1716 27645316 27643600 0 3025
7 TraesCS3D01G544200 chr7D 98.370 1718 26 2 1 1716 616591712 616593429 0 3016
8 TraesCS3D01G544200 chr7D 98.312 1718 27 2 1 1716 52435758 52434041 0 3011
9 TraesCS3D01G544200 chr7D 98.960 673 6 1 1713 2384 622013862 622013190 0 1203
10 TraesCS3D01G544200 chr5D 98.370 1718 26 2 1 1716 346023482 346025199 0 3016
11 TraesCS3D01G544200 chr6D 98.311 1717 27 2 1 1716 62913889 62915604 0 3009
12 TraesCS3D01G544200 chr6D 98.813 674 6 1 1713 2384 91155635 91154962 0 1199
13 TraesCS3D01G544200 chr4D 98.813 674 6 1 1713 2384 418842325 418842998 0 1199
14 TraesCS3D01G544200 chr4D 98.813 674 6 1 1713 2384 436829173 436829846 0 1199
15 TraesCS3D01G544200 chr4D 98.813 674 6 1 1713 2384 461407701 461407028 0 1199
16 TraesCS3D01G544200 chr1D 98.813 674 6 1 1713 2384 447346884 447346211 0 1199
17 TraesCS3D01G544200 chr1D 98.813 674 6 1 1713 2384 453647754 453647081 0 1199
18 TraesCS3D01G544200 chr1D 98.667 675 6 2 1713 2384 107456050 107455376 0 1194


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G544200 chr3D 613867370 613869753 2383 False 4403 4403 100.000 1 2384 1 chr3D.!!$F2 2383
1 TraesCS3D01G544200 chr3D 84530776 84532492 1716 False 3031 3031 98.545 1 1716 1 chr3D.!!$F1 1715
2 TraesCS3D01G544200 chr3D 54662662 54664379 1717 True 3027 3027 98.487 1 1716 1 chr3D.!!$R1 1715
3 TraesCS3D01G544200 chr3D 546355794 546357511 1717 True 3016 3016 98.370 1 1716 1 chr3D.!!$R2 1715
4 TraesCS3D01G544200 chr3D 560164784 560165455 671 True 1203 1203 98.960 1713 2384 1 chr3D.!!$R3 671
5 TraesCS3D01G544200 chr2D 559267716 559269432 1716 False 3031 3031 98.544 1 1716 1 chr2D.!!$F1 1715
6 TraesCS3D01G544200 chrUn 27643600 27645316 1716 True 3025 3025 98.487 1 1716 1 chrUn.!!$R1 1715
7 TraesCS3D01G544200 chr7D 616591712 616593429 1717 False 3016 3016 98.370 1 1716 1 chr7D.!!$F1 1715
8 TraesCS3D01G544200 chr7D 52434041 52435758 1717 True 3011 3011 98.312 1 1716 1 chr7D.!!$R1 1715
9 TraesCS3D01G544200 chr7D 622013190 622013862 672 True 1203 1203 98.960 1713 2384 1 chr7D.!!$R2 671
10 TraesCS3D01G544200 chr5D 346023482 346025199 1717 False 3016 3016 98.370 1 1716 1 chr5D.!!$F1 1715
11 TraesCS3D01G544200 chr6D 62913889 62915604 1715 False 3009 3009 98.311 1 1716 1 chr6D.!!$F1 1715
12 TraesCS3D01G544200 chr6D 91154962 91155635 673 True 1199 1199 98.813 1713 2384 1 chr6D.!!$R1 671
13 TraesCS3D01G544200 chr4D 418842325 418842998 673 False 1199 1199 98.813 1713 2384 1 chr4D.!!$F1 671
14 TraesCS3D01G544200 chr4D 436829173 436829846 673 False 1199 1199 98.813 1713 2384 1 chr4D.!!$F2 671
15 TraesCS3D01G544200 chr4D 461407028 461407701 673 True 1199 1199 98.813 1713 2384 1 chr4D.!!$R1 671
16 TraesCS3D01G544200 chr1D 447346211 447346884 673 True 1199 1199 98.813 1713 2384 1 chr1D.!!$R2 671
17 TraesCS3D01G544200 chr1D 453647081 453647754 673 True 1199 1199 98.813 1713 2384 1 chr1D.!!$R3 671
18 TraesCS3D01G544200 chr1D 107455376 107456050 674 True 1194 1194 98.667 1713 2384 1 chr1D.!!$R1 671

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
510 511 0.322456 CCCCCAAAAGATCGTGCTCA 60.322 55.0 0.00 0.0 0.00 4.26 F
861 864 1.022735 CAGGATGTCATGCAAGAGCC 58.977 55.0 7.12 0.0 41.13 4.70 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1381 1385 2.125326 CCATGTCCGACCGCTCCTA 61.125 63.158 0.0 0.0 0.0 2.94 R
2261 2268 8.017587 ACAGATTCAACAAAGACAACAAAAAC 57.982 30.769 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.084223 CCACTCAAAATGCTTGCATGTTTC 60.084 41.667 8.98 0.0 0.00 2.78
117 118 8.579006 TCAGAATTCATAGCAAAAAGACACAAT 58.421 29.630 8.44 0.0 0.00 2.71
158 159 0.603707 CCGCTTCTGGTTTGCTCTCA 60.604 55.000 0.00 0.0 0.00 3.27
196 197 2.833943 GCCCATGGTTTCCATTCTTCTT 59.166 45.455 11.73 0.0 42.23 2.52
510 511 0.322456 CCCCCAAAAGATCGTGCTCA 60.322 55.000 0.00 0.0 0.00 4.26
742 745 1.278985 TCCCATCTTCGATTGCAGTGT 59.721 47.619 0.00 0.0 0.00 3.55
861 864 1.022735 CAGGATGTCATGCAAGAGCC 58.977 55.000 7.12 0.0 41.13 4.70
960 963 6.575244 TTAGTTGGATGAGGTTGTGGATAT 57.425 37.500 0.00 0.0 0.00 1.63
1235 1238 1.257750 CGGGACTGTGAGGACATGGA 61.258 60.000 0.00 0.0 0.00 3.41
1381 1385 4.392940 GGATATGGACAACAAGCTGCTAT 58.607 43.478 0.90 0.0 0.00 2.97
2282 2289 7.826260 ATCGTTTTTGTTGTCTTTGTTGAAT 57.174 28.000 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 2.560105 CCTTCCCTTTTTCAGAAGCTGG 59.440 50.000 0.00 0.0 36.50 4.85
117 118 6.687139 GCGGGGAAGGTTAAATCTATGTTCTA 60.687 42.308 0.00 0.0 0.00 2.10
158 159 1.275010 GGGCGGGAATTTGTGAAATGT 59.725 47.619 0.00 0.0 0.00 2.71
196 197 2.967362 AGCGTTTGACAACCATATCGA 58.033 42.857 0.00 0.0 0.00 3.59
569 571 6.610020 CGGTAGAATGGGAAGGTATATATCCA 59.390 42.308 3.79 0.0 34.82 3.41
1381 1385 2.125326 CCATGTCCGACCGCTCCTA 61.125 63.158 0.00 0.0 0.00 2.94
2261 2268 8.017587 ACAGATTCAACAAAGACAACAAAAAC 57.982 30.769 0.00 0.0 0.00 2.43
2265 2272 8.600449 AAAAACAGATTCAACAAAGACAACAA 57.400 26.923 0.00 0.0 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.