Multiple sequence alignment - TraesCS3D01G520800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G520800 chr3D 100.000 2471 0 0 1 2471 602898321 602900791 0.000000e+00 4564
1 TraesCS3D01G520800 chr3D 96.257 1122 32 3 1 1112 399709644 399710765 0.000000e+00 1831
2 TraesCS3D01G520800 chr3D 96.429 756 23 2 934 1686 154784937 154784183 0.000000e+00 1243
3 TraesCS3D01G520800 chrUn 98.602 1502 20 1 971 2471 237254756 237253255 0.000000e+00 2656
4 TraesCS3D01G520800 chrUn 98.609 719 10 0 971 1689 371042384 371041666 0.000000e+00 1273
5 TraesCS3D01G520800 chrUn 96.830 757 18 2 934 1686 189418891 189418137 0.000000e+00 1260
6 TraesCS3D01G520800 chrUn 97.166 741 15 2 934 1669 410182909 410183648 0.000000e+00 1247
7 TraesCS3D01G520800 chrUn 98.551 69 1 0 934 1002 419930745 419930677 3.340000e-24 122
8 TraesCS3D01G520800 chr7D 98.602 1502 20 1 971 2471 579018653 579020154 0.000000e+00 2656
9 TraesCS3D01G520800 chr7D 96.915 1005 24 2 1468 2471 307122941 307123939 0.000000e+00 1677
10 TraesCS3D01G520800 chr7D 99.038 832 8 0 1 832 626641570 626640739 0.000000e+00 1493
11 TraesCS3D01G520800 chr7A 96.968 1550 34 4 934 2471 211223707 211225255 0.000000e+00 2590
12 TraesCS3D01G520800 chr5D 96.191 1129 30 5 1 1116 324472670 324471542 0.000000e+00 1834
13 TraesCS3D01G520800 chr6D 97.612 1005 23 1 1468 2471 102375283 102376287 0.000000e+00 1722
14 TraesCS3D01G520800 chr6A 97.433 1013 17 2 1468 2471 64685523 64684511 0.000000e+00 1718
15 TraesCS3D01G520800 chr3A 97.140 1014 19 3 1468 2471 633123807 633124820 0.000000e+00 1703
16 TraesCS3D01G520800 chr3A 98.345 846 14 0 1 846 725784699 725785544 0.000000e+00 1485
17 TraesCS3D01G520800 chr4B 96.940 1013 22 2 1468 2471 209062167 209061155 0.000000e+00 1690
18 TraesCS3D01G520800 chr2D 96.918 1006 28 3 1468 2471 604412210 604411206 0.000000e+00 1683
19 TraesCS3D01G520800 chr2D 97.344 753 20 0 934 1686 200931280 200930528 0.000000e+00 1280
20 TraesCS3D01G520800 chr7B 97.228 974 13 3 1507 2471 742964844 742963876 0.000000e+00 1637
21 TraesCS3D01G520800 chr4D 99.159 832 7 0 1 832 123530198 123531029 0.000000e+00 1498
22 TraesCS3D01G520800 chr4A 98.463 846 13 0 1 846 105655673 105654828 0.000000e+00 1491
23 TraesCS3D01G520800 chr4A 98.345 846 13 1 1 846 432417844 432417000 0.000000e+00 1483
24 TraesCS3D01G520800 chr4A 98.345 846 13 1 1 846 552129283 552128439 0.000000e+00 1483
25 TraesCS3D01G520800 chr3B 98.345 846 8 2 1 846 92231034 92230195 0.000000e+00 1480
26 TraesCS3D01G520800 chr1D 96.680 753 24 1 934 1686 185790229 185790980 0.000000e+00 1251


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G520800 chr3D 602898321 602900791 2470 False 4564 4564 100.000 1 2471 1 chr3D.!!$F2 2470
1 TraesCS3D01G520800 chr3D 399709644 399710765 1121 False 1831 1831 96.257 1 1112 1 chr3D.!!$F1 1111
2 TraesCS3D01G520800 chr3D 154784183 154784937 754 True 1243 1243 96.429 934 1686 1 chr3D.!!$R1 752
3 TraesCS3D01G520800 chrUn 237253255 237254756 1501 True 2656 2656 98.602 971 2471 1 chrUn.!!$R2 1500
4 TraesCS3D01G520800 chrUn 371041666 371042384 718 True 1273 1273 98.609 971 1689 1 chrUn.!!$R3 718
5 TraesCS3D01G520800 chrUn 189418137 189418891 754 True 1260 1260 96.830 934 1686 1 chrUn.!!$R1 752
6 TraesCS3D01G520800 chrUn 410182909 410183648 739 False 1247 1247 97.166 934 1669 1 chrUn.!!$F1 735
7 TraesCS3D01G520800 chr7D 579018653 579020154 1501 False 2656 2656 98.602 971 2471 1 chr7D.!!$F2 1500
8 TraesCS3D01G520800 chr7D 307122941 307123939 998 False 1677 1677 96.915 1468 2471 1 chr7D.!!$F1 1003
9 TraesCS3D01G520800 chr7D 626640739 626641570 831 True 1493 1493 99.038 1 832 1 chr7D.!!$R1 831
10 TraesCS3D01G520800 chr7A 211223707 211225255 1548 False 2590 2590 96.968 934 2471 1 chr7A.!!$F1 1537
11 TraesCS3D01G520800 chr5D 324471542 324472670 1128 True 1834 1834 96.191 1 1116 1 chr5D.!!$R1 1115
12 TraesCS3D01G520800 chr6D 102375283 102376287 1004 False 1722 1722 97.612 1468 2471 1 chr6D.!!$F1 1003
13 TraesCS3D01G520800 chr6A 64684511 64685523 1012 True 1718 1718 97.433 1468 2471 1 chr6A.!!$R1 1003
14 TraesCS3D01G520800 chr3A 633123807 633124820 1013 False 1703 1703 97.140 1468 2471 1 chr3A.!!$F1 1003
15 TraesCS3D01G520800 chr3A 725784699 725785544 845 False 1485 1485 98.345 1 846 1 chr3A.!!$F2 845
16 TraesCS3D01G520800 chr4B 209061155 209062167 1012 True 1690 1690 96.940 1468 2471 1 chr4B.!!$R1 1003
17 TraesCS3D01G520800 chr2D 604411206 604412210 1004 True 1683 1683 96.918 1468 2471 1 chr2D.!!$R2 1003
18 TraesCS3D01G520800 chr2D 200930528 200931280 752 True 1280 1280 97.344 934 1686 1 chr2D.!!$R1 752
19 TraesCS3D01G520800 chr7B 742963876 742964844 968 True 1637 1637 97.228 1507 2471 1 chr7B.!!$R1 964
20 TraesCS3D01G520800 chr4D 123530198 123531029 831 False 1498 1498 99.159 1 832 1 chr4D.!!$F1 831
21 TraesCS3D01G520800 chr4A 105654828 105655673 845 True 1491 1491 98.463 1 846 1 chr4A.!!$R1 845
22 TraesCS3D01G520800 chr4A 432417000 432417844 844 True 1483 1483 98.345 1 846 1 chr4A.!!$R2 845
23 TraesCS3D01G520800 chr4A 552128439 552129283 844 True 1483 1483 98.345 1 846 1 chr4A.!!$R3 845
24 TraesCS3D01G520800 chr3B 92230195 92231034 839 True 1480 1480 98.345 1 846 1 chr3B.!!$R1 845
25 TraesCS3D01G520800 chr1D 185790229 185790980 751 False 1251 1251 96.680 934 1686 1 chr1D.!!$F1 752

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
881 889 1.521681 CGGAAGCTAAGGGGAAGCG 60.522 63.158 0.0 0.0 44.87 4.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1863 1896 3.447944 AGCTTACTACAACTGAGGGTAGC 59.552 47.826 11.8 3.2 40.45 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
381 382 9.516546 AAATTTCTAGTAAGAGGAAAATCCGTT 57.483 29.630 0.00 0.0 42.75 4.44
409 410 5.988310 TCTAAATCGTGAGGGTTCAAGTA 57.012 39.130 0.00 0.0 34.49 2.24
433 434 5.648330 AGTCCCTCTATCCCCAATAAAAC 57.352 43.478 0.00 0.0 0.00 2.43
753 756 7.282585 TGCACAATAAATAGTCAGGATAGCTT 58.717 34.615 0.00 0.0 0.00 3.74
834 837 2.884012 ACAGAACGAACAATGAATGCCA 59.116 40.909 0.00 0.0 0.00 4.92
838 841 5.406175 CAGAACGAACAATGAATGCCATTTT 59.594 36.000 0.00 0.0 42.55 1.82
881 889 1.521681 CGGAAGCTAAGGGGAAGCG 60.522 63.158 0.00 0.0 44.87 4.68
903 911 4.095483 CGGAATCAACAAGAAATCCAGGAG 59.905 45.833 0.00 0.0 36.56 3.69
904 912 4.400567 GGAATCAACAAGAAATCCAGGAGG 59.599 45.833 0.00 0.0 36.69 4.30
1140 1159 5.534207 TTCTCAAACTACGGAACCAACTA 57.466 39.130 0.00 0.0 0.00 2.24
1151 1170 1.193874 GAACCAACTACTTTCGCACCG 59.806 52.381 0.00 0.0 0.00 4.94
1340 1360 5.654603 TTCGGAGAAATAAGTAGCTCACA 57.345 39.130 0.00 0.0 45.90 3.58
1445 1469 2.275134 ATGCTCACACATGTTCCACA 57.725 45.000 0.00 0.0 0.00 4.17
1446 1470 1.308047 TGCTCACACATGTTCCACAC 58.692 50.000 0.00 0.0 0.00 3.82
1456 1480 1.966451 GTTCCACACGGGCAAGGAG 60.966 63.158 0.00 0.0 36.21 3.69
1460 1484 4.335647 ACACGGGCAAGGAGGCAG 62.336 66.667 0.00 0.0 46.44 4.85
1839 1872 7.333528 TCTTCCTATCACCAATAACAAATGC 57.666 36.000 0.00 0.0 0.00 3.56
1994 2028 5.237127 TCTTTAATATCGATGGCAGCAACTG 59.763 40.000 8.54 0.0 34.12 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
381 382 4.884668 ACCCTCACGATTTAGAAAGTCA 57.115 40.909 0.00 0.0 0.00 3.41
409 410 6.432581 GTTTTATTGGGGATAGAGGGACTTT 58.567 40.000 0.00 0.0 41.55 2.66
433 434 6.317893 ACAATAGTTAGGAAGTAAAATGGGCG 59.682 38.462 0.00 0.0 0.00 6.13
753 756 4.610333 TCAATCCTCTGCTCTACCAACTA 58.390 43.478 0.00 0.0 0.00 2.24
864 872 1.153147 CCGCTTCCCCTTAGCTTCC 60.153 63.158 0.00 0.0 36.49 3.46
881 889 4.400567 CCTCCTGGATTTCTTGTTGATTCC 59.599 45.833 0.00 0.0 34.57 3.01
917 931 4.912214 TCTATACGCGATTCGAGAAAACA 58.088 39.130 15.93 0.0 41.67 2.83
928 942 8.981724 TTTGCTATTTTCTATCTATACGCGAT 57.018 30.769 15.93 4.5 0.00 4.58
1333 1353 2.235898 GTCTCTCCATTCCTTGTGAGCT 59.764 50.000 0.00 0.0 0.00 4.09
1445 1469 1.271840 TATTCTGCCTCCTTGCCCGT 61.272 55.000 0.00 0.0 0.00 5.28
1446 1470 0.109342 ATATTCTGCCTCCTTGCCCG 59.891 55.000 0.00 0.0 0.00 6.13
1456 1480 2.880890 ACGGCTTTCATGATATTCTGCC 59.119 45.455 0.00 0.0 36.14 4.85
1460 1484 7.658179 TTATCAGACGGCTTTCATGATATTC 57.342 36.000 0.00 0.0 33.98 1.75
1593 1617 5.105595 TCCATGAACAGAGATCACTACACAG 60.106 44.000 0.00 0.0 0.00 3.66
1623 1647 0.616395 TTCGGGTATCAGTGGCCTCA 60.616 55.000 3.32 0.0 0.00 3.86
1775 1808 6.296026 ACTAGCATTGAACAACCTACTTCAA 58.704 36.000 0.00 0.0 39.95 2.69
1863 1896 3.447944 AGCTTACTACAACTGAGGGTAGC 59.552 47.826 11.80 3.2 40.45 3.58
1994 2028 7.192232 GCAGTAATCTGATTGAGAAAATGGAC 58.808 38.462 13.01 0.0 43.76 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.