Multiple sequence alignment - TraesCS3D01G520600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G520600 chr3D 100.000 2314 0 0 1 2314 602873032 602875345 0.000000e+00 4274
1 TraesCS3D01G520600 chr3D 97.980 99 2 0 2216 2314 572093126 572093028 3.060000e-39 172
2 TraesCS3D01G520600 chr7D 98.618 2315 31 1 1 2314 382073379 382071065 0.000000e+00 4096
3 TraesCS3D01G520600 chr7D 98.618 2315 30 2 1 2314 626630213 626632526 0.000000e+00 4096
4 TraesCS3D01G520600 chr7D 98.618 2315 29 3 1 2314 626724465 626726777 0.000000e+00 4095
5 TraesCS3D01G520600 chr1D 98.488 2315 32 3 1 2314 212458839 212461151 0.000000e+00 4078
6 TraesCS3D01G520600 chr4D 98.143 2315 40 3 1 2314 123545918 123543606 0.000000e+00 4034
7 TraesCS3D01G520600 chr4D 97.754 2315 49 3 1 2314 123388256 123385944 0.000000e+00 3984
8 TraesCS3D01G520600 chrUn 98.705 2239 26 2 1 2238 170995032 170992796 0.000000e+00 3971
9 TraesCS3D01G520600 chrUn 98.876 89 1 0 2226 2314 404476249 404476337 2.380000e-35 159
10 TraesCS3D01G520600 chr7B 98.571 2239 30 2 1 2238 644446412 644448649 0.000000e+00 3956
11 TraesCS3D01G520600 chr7B 98.571 2239 30 2 1 2238 743095875 743098112 0.000000e+00 3956
12 TraesCS3D01G520600 chr6B 98.876 89 1 0 2226 2314 394408748 394408660 2.380000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G520600 chr3D 602873032 602875345 2313 False 4274 4274 100.000 1 2314 1 chr3D.!!$F1 2313
1 TraesCS3D01G520600 chr7D 382071065 382073379 2314 True 4096 4096 98.618 1 2314 1 chr7D.!!$R1 2313
2 TraesCS3D01G520600 chr7D 626630213 626632526 2313 False 4096 4096 98.618 1 2314 1 chr7D.!!$F1 2313
3 TraesCS3D01G520600 chr7D 626724465 626726777 2312 False 4095 4095 98.618 1 2314 1 chr7D.!!$F2 2313
4 TraesCS3D01G520600 chr1D 212458839 212461151 2312 False 4078 4078 98.488 1 2314 1 chr1D.!!$F1 2313
5 TraesCS3D01G520600 chr4D 123543606 123545918 2312 True 4034 4034 98.143 1 2314 1 chr4D.!!$R2 2313
6 TraesCS3D01G520600 chr4D 123385944 123388256 2312 True 3984 3984 97.754 1 2314 1 chr4D.!!$R1 2313
7 TraesCS3D01G520600 chrUn 170992796 170995032 2236 True 3971 3971 98.705 1 2238 1 chrUn.!!$R1 2237
8 TraesCS3D01G520600 chr7B 644446412 644448649 2237 False 3956 3956 98.571 1 2238 1 chr7B.!!$F1 2237
9 TraesCS3D01G520600 chr7B 743095875 743098112 2237 False 3956 3956 98.571 1 2238 1 chr7B.!!$F2 2237

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
613 614 0.521735 CCTGGCAAAAGAAGTACGGC 59.478 55.0 0.0 0.0 0.0 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1790 1794 1.547372 GTCCATTGCTGGCTTGAATGT 59.453 47.619 0.0 0.0 42.8 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 3.737266 CACTAGCACAAGCAAAAATGGTG 59.263 43.478 0.00 0.00 45.49 4.17
424 425 2.164422 TCAGGCTATCGAACACAGAGTG 59.836 50.000 0.00 0.00 39.75 3.51
613 614 0.521735 CCTGGCAAAAGAAGTACGGC 59.478 55.000 0.00 0.00 0.00 5.68
719 720 1.603842 CTGCCTGGCACTGTATGGA 59.396 57.895 19.30 0.00 33.79 3.41
786 787 6.592607 TGATTAACTACCGAAGCGAAGAAAAT 59.407 34.615 0.00 0.00 0.00 1.82
1053 1055 1.267574 ATCGCTCCCACACCTGTCAT 61.268 55.000 0.00 0.00 0.00 3.06
1077 1079 1.112113 GTGATCGGCCTCCTCAACTA 58.888 55.000 0.00 0.00 0.00 2.24
1228 1230 1.956170 CGGAACAACTGCAGCGTCT 60.956 57.895 15.27 2.72 0.00 4.18
1376 1378 4.614284 CAGTGCGACTTCATAAAAAGCAAG 59.386 41.667 0.00 0.00 34.81 4.01
1377 1379 4.515191 AGTGCGACTTCATAAAAAGCAAGA 59.485 37.500 0.00 0.00 34.81 3.02
1606 1610 6.801539 ATAAGCACTTTCGACTTGATTTGA 57.198 33.333 0.00 0.00 0.00 2.69
1790 1794 4.302455 CGAGCAAAGAAGAAGAGAGACAA 58.698 43.478 0.00 0.00 0.00 3.18
1849 1853 0.392595 GGTAAAGAGAAGGGGCCGTG 60.393 60.000 0.00 0.00 0.00 4.94
1862 1866 1.528292 GGCCGTGGTTGGTGCATAAA 61.528 55.000 0.00 0.00 0.00 1.40
1864 1868 1.067213 GCCGTGGTTGGTGCATAAAAT 60.067 47.619 0.00 0.00 0.00 1.82
2156 2161 0.036875 AGCCTTGTTCCTTCTTCCGG 59.963 55.000 0.00 0.00 0.00 5.14
2251 2256 1.539869 AGGAAGAAGCAGCTCCCCA 60.540 57.895 0.00 0.00 0.00 4.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 7.496263 ACTCTCTTTCAAACAGTAGACTTTTCC 59.504 37.037 0.00 0.0 0.00 3.13
400 401 1.204704 CTGTGTTCGATAGCCTGACCA 59.795 52.381 0.00 0.0 0.00 4.02
424 425 4.142881 GGCCTGACTCGTAATTCACTTTTC 60.143 45.833 0.00 0.0 0.00 2.29
613 614 0.890996 AGTGGCAAAGGAAAGCGAGG 60.891 55.000 0.00 0.0 0.00 4.63
719 720 1.066143 GCCTGCACGCCATACCTATAT 60.066 52.381 0.00 0.0 0.00 0.86
786 787 1.272648 CCCCCTTTTCTTGATCCAGCA 60.273 52.381 0.00 0.0 0.00 4.41
1053 1055 1.945354 GAGGAGGCCGATCACGAACA 61.945 60.000 0.00 0.0 42.66 3.18
1077 1079 2.289072 CCCTGCCTTTCGATCGATACAT 60.289 50.000 20.18 0.0 0.00 2.29
1228 1230 4.263506 TGCCGAGTAGATAGATCAGATCCA 60.264 45.833 6.80 0.0 0.00 3.41
1606 1610 2.480845 GTCTTGCGTAACTGACCACTT 58.519 47.619 0.00 0.0 0.00 3.16
1750 1754 2.853731 CGCGAGAGTGAATAAGAGGT 57.146 50.000 0.00 0.0 46.66 3.85
1790 1794 1.547372 GTCCATTGCTGGCTTGAATGT 59.453 47.619 0.00 0.0 42.80 2.71
1849 1853 7.112452 AGGAAAGATATTTTATGCACCAACC 57.888 36.000 0.00 0.0 0.00 3.77
1864 1868 8.937884 CGAGAAAGATCGTAGATAGGAAAGATA 58.062 37.037 0.00 0.0 45.12 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.