Multiple sequence alignment - TraesCS3D01G500400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G500400 chr3D 100.000 2483 0 0 1 2483 589673352 589670870 0.000000e+00 4586.0
1 TraesCS3D01G500400 chr2D 97.244 2504 44 7 1 2483 19555590 19558089 0.000000e+00 4218.0
2 TraesCS3D01G500400 chr2D 83.664 1763 176 55 130 1834 10220610 10218902 0.000000e+00 1557.0
3 TraesCS3D01G500400 chr2D 83.191 351 42 10 1568 1916 19520803 19521138 3.100000e-79 305.0
4 TraesCS3D01G500400 chr2D 84.362 243 28 5 1324 1557 19520588 19520829 1.920000e-56 230.0
5 TraesCS3D01G500400 chr1B 91.588 1581 85 15 1 1557 44799557 44801113 0.000000e+00 2139.0
6 TraesCS3D01G500400 chr1B 85.577 208 25 4 1915 2119 588446897 588446692 1.930000e-51 213.0
7 TraesCS3D01G500400 chr1B 95.238 42 2 0 1653 1694 44801148 44801189 1.590000e-07 67.6
8 TraesCS3D01G500400 chrUn 88.855 1301 89 19 272 1557 3511167 3509908 0.000000e+00 1548.0
9 TraesCS3D01G500400 chrUn 82.323 1782 195 62 125 1834 12288510 12286777 0.000000e+00 1435.0
10 TraesCS3D01G500400 chrUn 79.689 1157 206 21 196 1338 150896580 150895439 0.000000e+00 808.0
11 TraesCS3D01G500400 chrUn 82.027 957 153 14 203 1151 8821 9766 0.000000e+00 797.0
12 TraesCS3D01G500400 chrUn 79.299 1169 208 19 196 1338 150935574 150934414 0.000000e+00 787.0
13 TraesCS3D01G500400 chrUn 93.333 270 15 1 1 270 3513587 3513321 1.790000e-106 396.0
14 TraesCS3D01G500400 chrUn 93.333 270 15 1 1 270 244466740 244466474 1.790000e-106 396.0
15 TraesCS3D01G500400 chrUn 93.333 270 15 1 1 270 324102287 324102021 1.790000e-106 396.0
16 TraesCS3D01G500400 chrUn 85.942 377 26 9 1187 1557 366506578 366506223 6.480000e-101 377.0
17 TraesCS3D01G500400 chrUn 90.385 52 5 0 1653 1704 3509864 3509813 4.430000e-08 69.4
18 TraesCS3D01G500400 chrUn 90.385 52 5 0 1653 1704 366506179 366506128 4.430000e-08 69.4
19 TraesCS3D01G500400 chr2A 81.664 1538 211 32 1 1498 10486944 10485438 0.000000e+00 1212.0
20 TraesCS3D01G500400 chr2A 89.268 205 22 0 1915 2119 26933183 26932979 8.810000e-65 257.0
21 TraesCS3D01G500400 chr2B 80.777 1415 204 41 115 1490 4493275 4494660 0.000000e+00 1044.0
22 TraesCS3D01G500400 chr2B 85.222 203 30 0 1917 2119 134508970 134508768 2.500000e-50 209.0
23 TraesCS3D01G500400 chr2B 87.500 176 19 1 1015 1190 38731794 38731622 1.510000e-47 200.0
24 TraesCS3D01G500400 chr4D 87.317 205 26 0 1915 2119 6262746 6262542 4.130000e-58 235.0
25 TraesCS3D01G500400 chr1A 85.437 206 29 1 1915 2119 329187784 329187989 1.930000e-51 213.0
26 TraesCS3D01G500400 chr7D 85.577 208 23 5 1916 2119 515487231 515487027 6.960000e-51 211.0
27 TraesCS3D01G500400 chr1D 84.475 219 28 5 1906 2119 110976202 110975985 6.960000e-51 211.0
28 TraesCS3D01G500400 chr5D 85.167 209 26 4 1915 2119 536239520 536239727 2.500000e-50 209.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G500400 chr3D 589670870 589673352 2482 True 4586.000000 4586 100.000000 1 2483 1 chr3D.!!$R1 2482
1 TraesCS3D01G500400 chr2D 19555590 19558089 2499 False 4218.000000 4218 97.244000 1 2483 1 chr2D.!!$F1 2482
2 TraesCS3D01G500400 chr2D 10218902 10220610 1708 True 1557.000000 1557 83.664000 130 1834 1 chr2D.!!$R1 1704
3 TraesCS3D01G500400 chr2D 19520588 19521138 550 False 267.500000 305 83.776500 1324 1916 2 chr2D.!!$F2 592
4 TraesCS3D01G500400 chr1B 44799557 44801189 1632 False 1103.300000 2139 93.413000 1 1694 2 chr1B.!!$F1 1693
5 TraesCS3D01G500400 chrUn 12286777 12288510 1733 True 1435.000000 1435 82.323000 125 1834 1 chrUn.!!$R1 1709
6 TraesCS3D01G500400 chrUn 150895439 150896580 1141 True 808.000000 808 79.689000 196 1338 1 chrUn.!!$R2 1142
7 TraesCS3D01G500400 chrUn 8821 9766 945 False 797.000000 797 82.027000 203 1151 1 chrUn.!!$F1 948
8 TraesCS3D01G500400 chrUn 150934414 150935574 1160 True 787.000000 787 79.299000 196 1338 1 chrUn.!!$R3 1142
9 TraesCS3D01G500400 chrUn 3509813 3513587 3774 True 671.133333 1548 90.857667 1 1704 3 chrUn.!!$R6 1703
10 TraesCS3D01G500400 chr2A 10485438 10486944 1506 True 1212.000000 1212 81.664000 1 1498 1 chr2A.!!$R1 1497
11 TraesCS3D01G500400 chr2B 4493275 4494660 1385 False 1044.000000 1044 80.777000 115 1490 1 chr2B.!!$F1 1375

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
973 3162 1.301716 GAGAAGGACACCTTGCGCA 60.302 57.895 5.66 5.66 44.82 6.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2417 4729 1.333931 CTCATGATCGCAGCTGCATTT 59.666 47.619 36.03 20.85 42.21 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
154 167 2.554806 ATCAAACACGATGCATGCAG 57.445 45.000 26.69 15.79 0.00 4.41
173 186 2.094649 CAGACAAGAGTTCTCCGGTACC 60.095 54.545 0.16 0.16 0.00 3.34
810 2999 1.749638 CGAGCTAGTCTGGGACGGT 60.750 63.158 0.00 0.00 37.67 4.83
973 3162 1.301716 GAGAAGGACACCTTGCGCA 60.302 57.895 5.66 5.66 44.82 6.09
1397 3637 4.072839 GGGTTATCTTTGGGCTATGCTAC 58.927 47.826 0.00 0.00 0.00 3.58
2007 4319 7.573968 AAACTTATAACCAGATCAATGGAGC 57.426 36.000 7.95 0.00 43.57 4.70
2156 4468 4.322650 GCATTCACTAAGGGGATTTGCAAA 60.323 41.667 15.44 15.44 0.00 3.68
2224 4536 1.815421 GAGTCGGCGGATGTGCAAT 60.815 57.895 7.21 0.00 36.28 3.56
2281 4593 3.243168 CCATCTCACCCATTTATTGCACG 60.243 47.826 0.00 0.00 0.00 5.34
2372 4684 2.577757 TTCTACCTCCCCCTGCCCT 61.578 63.158 0.00 0.00 0.00 5.19
2405 4717 4.871557 TCCGTATGGGTTTGATACTTTTCG 59.128 41.667 0.00 0.00 37.00 3.46
2433 4745 1.020861 ACGAAATGCAGCTGCGATCA 61.021 50.000 32.11 16.56 45.83 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
154 167 1.891150 TGGTACCGGAGAACTCTTGTC 59.109 52.381 9.46 0.00 0.00 3.18
173 186 1.401931 CGGCATCCTTCTTGTTGCTTG 60.402 52.381 0.00 0.00 35.46 4.01
732 2921 1.596934 GATGACAAGCCCCTCGACA 59.403 57.895 0.00 0.00 0.00 4.35
1028 3217 0.037326 TGTCACCGCCTTCTCATCAC 60.037 55.000 0.00 0.00 0.00 3.06
1397 3637 4.764823 TGTTGGTCTTGTTATTAAGCCTGG 59.235 41.667 0.00 0.00 0.00 4.45
1624 3904 6.183360 TGGATAAGGGTCTCGGTATAACTTTG 60.183 42.308 0.00 0.00 0.00 2.77
1744 4056 5.185828 TCATACATCCCTGATCCATCTTACG 59.814 44.000 0.00 0.00 0.00 3.18
1809 4121 7.015877 AGGTTGAGGACTAGTGTACACAATTTA 59.984 37.037 27.06 10.26 39.21 1.40
1931 4243 8.725148 GCCGTGATTGATAAATAGATTGAGAAT 58.275 33.333 0.00 0.00 0.00 2.40
1934 4246 7.172190 ACTGCCGTGATTGATAAATAGATTGAG 59.828 37.037 0.00 0.00 0.00 3.02
2001 4313 1.753078 TCGTCGCTAGGTGCTCCAT 60.753 57.895 7.70 0.00 40.11 3.41
2007 4319 1.794437 GCTTGTAGTCGTCGCTAGGTG 60.794 57.143 0.00 0.00 0.00 4.00
2065 4377 1.830408 CCCGGCTCTAGTGAGGGAG 60.830 68.421 16.32 0.00 44.70 4.30
2156 4468 4.457603 TGTGTTCTTAAATACAAGCCGCAT 59.542 37.500 0.00 0.00 34.07 4.73
2372 4684 1.880796 CCATACGGACATTCGCGCA 60.881 57.895 8.75 0.00 0.00 6.09
2405 4717 4.606012 GCAGCTGCATTTCGTTTTGTTAAC 60.606 41.667 33.36 0.00 41.59 2.01
2417 4729 1.333931 CTCATGATCGCAGCTGCATTT 59.666 47.619 36.03 20.85 42.21 2.32
2433 4745 5.456548 TGTTTTCATGATGTGTTGCTCAT 57.543 34.783 0.00 0.00 32.37 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.