Multiple sequence alignment - TraesCS3D01G499500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G499500 chr3D 100.000 2498 0 0 1 2498 589278901 589281398 0.000000e+00 4614
1 TraesCS3D01G499500 chr5D 98.641 2502 29 4 1 2498 6189583 6187083 0.000000e+00 4427
2 TraesCS3D01G499500 chr5D 98.601 2501 31 3 1 2498 503277583 503280082 0.000000e+00 4421
3 TraesCS3D01G499500 chr5D 97.723 2503 48 8 1 2498 432402854 432405352 0.000000e+00 4298
4 TraesCS3D01G499500 chr5D 99.235 2092 13 2 1 2089 503218861 503216770 0.000000e+00 3771
5 TraesCS3D01G499500 chr1D 98.441 2502 35 3 1 2498 254397466 254399967 0.000000e+00 4401
6 TraesCS3D01G499500 chr5A 97.601 2501 54 5 1 2496 607275043 607272544 0.000000e+00 4281
7 TraesCS3D01G499500 chr4B 96.605 2504 64 8 1 2498 308697113 308694625 0.000000e+00 4133
8 TraesCS3D01G499500 chr4A 96.295 2510 79 9 1 2498 309515773 309513266 0.000000e+00 4108
9 TraesCS3D01G499500 chr6D 99.283 2093 11 3 1 2089 168255569 168253477 0.000000e+00 3779
10 TraesCS3D01G499500 chrUn 99.188 2093 12 4 1 2089 93408988 93411079 0.000000e+00 3766
11 TraesCS3D01G499500 chrUn 98.328 658 11 0 1841 2498 239345464 239346121 0.000000e+00 1155
12 TraesCS3D01G499500 chr6B 99.060 319 3 0 2137 2455 450080812 450081130 7.750000e-160 573
13 TraesCS3D01G499500 chr3A 100.000 100 0 0 2073 2172 336825433 336825532 4.240000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G499500 chr3D 589278901 589281398 2497 False 4614 4614 100.000 1 2498 1 chr3D.!!$F1 2497
1 TraesCS3D01G499500 chr5D 6187083 6189583 2500 True 4427 4427 98.641 1 2498 1 chr5D.!!$R1 2497
2 TraesCS3D01G499500 chr5D 503277583 503280082 2499 False 4421 4421 98.601 1 2498 1 chr5D.!!$F2 2497
3 TraesCS3D01G499500 chr5D 432402854 432405352 2498 False 4298 4298 97.723 1 2498 1 chr5D.!!$F1 2497
4 TraesCS3D01G499500 chr5D 503216770 503218861 2091 True 3771 3771 99.235 1 2089 1 chr5D.!!$R2 2088
5 TraesCS3D01G499500 chr1D 254397466 254399967 2501 False 4401 4401 98.441 1 2498 1 chr1D.!!$F1 2497
6 TraesCS3D01G499500 chr5A 607272544 607275043 2499 True 4281 4281 97.601 1 2496 1 chr5A.!!$R1 2495
7 TraesCS3D01G499500 chr4B 308694625 308697113 2488 True 4133 4133 96.605 1 2498 1 chr4B.!!$R1 2497
8 TraesCS3D01G499500 chr4A 309513266 309515773 2507 True 4108 4108 96.295 1 2498 1 chr4A.!!$R1 2497
9 TraesCS3D01G499500 chr6D 168253477 168255569 2092 True 3779 3779 99.283 1 2089 1 chr6D.!!$R1 2088
10 TraesCS3D01G499500 chrUn 93408988 93411079 2091 False 3766 3766 99.188 1 2089 1 chrUn.!!$F1 2088
11 TraesCS3D01G499500 chrUn 239345464 239346121 657 False 1155 1155 98.328 1841 2498 1 chrUn.!!$F2 657

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
643 646 2.664851 CGCACAGAACCGGAAGCA 60.665 61.111 9.46 0.0 0.0 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2202 2219 3.954904 CCCTCTAGACTTAGCTGCTGTTA 59.045 47.826 13.43 0.0 0.0 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 106 7.763528 TGAAATCCAATCCACGAAATAATTTGG 59.236 33.333 0.00 0.0 0.00 3.28
643 646 2.664851 CGCACAGAACCGGAAGCA 60.665 61.111 9.46 0.0 0.00 3.91
667 670 2.816672 CCTTGTTTCAAAGAGAGGAGGC 59.183 50.000 0.00 0.0 0.00 4.70
1231 1235 4.041938 AGGTCCGTTTAGTATCCCAAAACA 59.958 41.667 0.00 0.0 33.67 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
643 646 2.783510 TCCTCTCTTTGAAACAAGGGGT 59.216 45.455 2.41 0.0 0.0 4.95
667 670 7.437862 CCATCAAATTAAATGTGAATAACCCGG 59.562 37.037 0.00 0.0 0.0 5.73
1231 1235 0.679505 TGTCCGACTGTTGCTAAGCT 59.320 50.000 0.00 0.0 0.0 3.74
1772 1786 5.245531 TGATGAGCTACAAAAGGATTCGTT 58.754 37.500 0.00 0.0 0.0 3.85
2202 2219 3.954904 CCCTCTAGACTTAGCTGCTGTTA 59.045 47.826 13.43 0.0 0.0 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.