Multiple sequence alignment - TraesCS3D01G499400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G499400 chr3D 100.000 2414 0 0 1 2414 589281292 589278879 0.000000e+00 4458
1 TraesCS3D01G499400 chr5D 98.677 2418 27 4 1 2414 6187189 6189605 0.000000e+00 4283
2 TraesCS3D01G499400 chr5D 98.593 2417 30 3 1 2414 503279976 503277561 0.000000e+00 4272
3 TraesCS3D01G499400 chr5D 97.644 2419 48 8 1 2414 432405246 432402832 0.000000e+00 4143
4 TraesCS3D01G499400 chr5D 99.243 2114 13 2 304 2414 503216770 503218883 0.000000e+00 3812
5 TraesCS3D01G499400 chr1D 98.387 2418 35 3 1 2414 254399861 254397444 0.000000e+00 4246
6 TraesCS3D01G499400 chr5A 97.561 2419 53 5 1 2414 607272648 607275065 0.000000e+00 4135
7 TraesCS3D01G499400 chr4B 96.572 2421 61 9 1 2414 308694731 308697136 0.000000e+00 3991
8 TraesCS3D01G499400 chr4A 96.208 2426 78 9 1 2414 309513372 309515795 0.000000e+00 3958
9 TraesCS3D01G499400 chr6D 99.291 2115 11 3 304 2414 168253477 168255591 0.000000e+00 3819
10 TraesCS3D01G499400 chrUn 99.196 2115 12 4 304 2414 93411079 93408966 0.000000e+00 3807
11 TraesCS3D01G499400 chrUn 98.188 552 10 0 1 552 239346015 239345464 0.000000e+00 965
12 TraesCS3D01G499400 chr6B 98.828 256 3 0 1 256 450081067 450080812 7.870000e-125 457
13 TraesCS3D01G499400 chr3A 100.000 100 0 0 221 320 336825532 336825433 4.100000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G499400 chr3D 589278879 589281292 2413 True 4458 4458 100.000 1 2414 1 chr3D.!!$R1 2413
1 TraesCS3D01G499400 chr5D 6187189 6189605 2416 False 4283 4283 98.677 1 2414 1 chr5D.!!$F1 2413
2 TraesCS3D01G499400 chr5D 503277561 503279976 2415 True 4272 4272 98.593 1 2414 1 chr5D.!!$R2 2413
3 TraesCS3D01G499400 chr5D 432402832 432405246 2414 True 4143 4143 97.644 1 2414 1 chr5D.!!$R1 2413
4 TraesCS3D01G499400 chr5D 503216770 503218883 2113 False 3812 3812 99.243 304 2414 1 chr5D.!!$F2 2110
5 TraesCS3D01G499400 chr1D 254397444 254399861 2417 True 4246 4246 98.387 1 2414 1 chr1D.!!$R1 2413
6 TraesCS3D01G499400 chr5A 607272648 607275065 2417 False 4135 4135 97.561 1 2414 1 chr5A.!!$F1 2413
7 TraesCS3D01G499400 chr4B 308694731 308697136 2405 False 3991 3991 96.572 1 2414 1 chr4B.!!$F1 2413
8 TraesCS3D01G499400 chr4A 309513372 309515795 2423 False 3958 3958 96.208 1 2414 1 chr4A.!!$F1 2413
9 TraesCS3D01G499400 chr6D 168253477 168255591 2114 False 3819 3819 99.291 304 2414 1 chr6D.!!$F1 2110
10 TraesCS3D01G499400 chrUn 93408966 93411079 2113 True 3807 3807 99.196 304 2414 1 chrUn.!!$R1 2110
11 TraesCS3D01G499400 chrUn 239345464 239346015 551 True 965 965 98.188 1 552 1 chrUn.!!$R2 551

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
189 196 3.954904 CCCTCTAGACTTAGCTGCTGTTA 59.045 47.826 13.43 0.0 0.0 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1748 1781 2.664851 CGCACAGAACCGGAAGCA 60.665 61.111 9.46 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
189 196 3.954904 CCCTCTAGACTTAGCTGCTGTTA 59.045 47.826 13.43 0.0 0.0 2.41
1160 1190 0.679505 TGTCCGACTGTTGCTAAGCT 59.320 50.000 0.00 0.0 0.0 3.74
1724 1757 7.437862 CCATCAAATTAAATGTGAATAACCCGG 59.562 37.037 0.00 0.0 0.0 5.73
1748 1781 2.783510 TCCTCTCTTTGAAACAAGGGGT 59.216 45.455 2.41 0.0 0.0 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1160 1190 4.041938 AGGTCCGTTTAGTATCCCAAAACA 59.958 41.667 0.00 0.0 33.67 2.83
1724 1757 2.816672 CCTTGTTTCAAAGAGAGGAGGC 59.183 50.000 0.00 0.0 0.00 4.70
1748 1781 2.664851 CGCACAGAACCGGAAGCA 60.665 61.111 9.46 0.0 0.00 3.91
2286 2321 7.763528 TGAAATCCAATCCACGAAATAATTTGG 59.236 33.333 0.00 0.0 0.00 3.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.