Multiple sequence alignment - TraesCS3D01G499300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G499300 chr3D 100.000 2162 0 0 1 2162 589280055 589277894 0 3993
1 TraesCS3D01G499300 chr3B 99.076 2165 17 2 1 2162 201526511 201528675 0 3884
2 TraesCS3D01G499300 chr1A 98.984 2165 19 2 1 2162 554511735 554513899 0 3873
3 TraesCS3D01G499300 chr5D 98.938 2165 20 2 1 2162 503217705 503219869 0 3868
4 TraesCS3D01G499300 chr5D 98.614 2165 27 2 1 2162 503278739 503276575 0 3829
5 TraesCS3D01G499300 chr5D 98.430 2165 31 2 1 2162 6188427 6190591 0 3807
6 TraesCS3D01G499300 chr6D 98.753 2165 24 2 1 2162 168254413 168256577 0 3845
7 TraesCS3D01G499300 chrUn 98.430 2165 30 3 1 2162 216519115 216516952 0 3807
8 TraesCS3D01G499300 chr3A 98.383 2165 31 3 1 2162 672910520 672908357 0 3801
9 TraesCS3D01G499300 chr3A 98.245 2165 35 2 1 2162 594900137 594897973 0 3784


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G499300 chr3D 589277894 589280055 2161 True 3993 3993 100.000 1 2162 1 chr3D.!!$R1 2161
1 TraesCS3D01G499300 chr3B 201526511 201528675 2164 False 3884 3884 99.076 1 2162 1 chr3B.!!$F1 2161
2 TraesCS3D01G499300 chr1A 554511735 554513899 2164 False 3873 3873 98.984 1 2162 1 chr1A.!!$F1 2161
3 TraesCS3D01G499300 chr5D 503217705 503219869 2164 False 3868 3868 98.938 1 2162 1 chr5D.!!$F2 2161
4 TraesCS3D01G499300 chr5D 503276575 503278739 2164 True 3829 3829 98.614 1 2162 1 chr5D.!!$R1 2161
5 TraesCS3D01G499300 chr5D 6188427 6190591 2164 False 3807 3807 98.430 1 2162 1 chr5D.!!$F1 2161
6 TraesCS3D01G499300 chr6D 168254413 168256577 2164 False 3845 3845 98.753 1 2162 1 chr6D.!!$F1 2161
7 TraesCS3D01G499300 chrUn 216516952 216519115 2163 True 3807 3807 98.430 1 2162 1 chrUn.!!$R1 2161
8 TraesCS3D01G499300 chr3A 672908357 672910520 2163 True 3801 3801 98.383 1 2162 1 chr3A.!!$R2 2161
9 TraesCS3D01G499300 chr3A 594897973 594900137 2164 True 3784 3784 98.245 1 2162 1 chr3A.!!$R1 2161

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
487 488 7.437862 CCATCAAATTAAATGTGAATAACCCGG 59.562 37.037 0.0 0.0 0.0 5.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1449 1453 1.27758 AACTCAGAGCATGGGAGGGG 61.278 60.0 0.0 0.0 31.77 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
487 488 7.437862 CCATCAAATTAAATGTGAATAACCCGG 59.562 37.037 0.00 0.00 0.00 5.73
1322 1325 5.359860 CCACCTTAACACCAAAGAAGAGTTT 59.640 40.000 0.00 0.00 0.00 2.66
1449 1453 7.496529 TTGATTCCATCCATAAATCGACTTC 57.503 36.000 0.00 0.00 33.13 3.01
1456 1460 2.224548 CCATAAATCGACTTCCCCTCCC 60.225 54.545 0.00 0.00 0.00 4.30
1898 1902 7.199167 TGGATCCAATTCTATTGAGTCTGAA 57.801 36.000 13.46 0.00 0.00 3.02
2048 2052 7.667575 ATAGATCCTCTTTAGCAGAAAGACA 57.332 36.000 9.16 1.65 33.20 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
487 488 2.816672 CCTTGTTTCAAAGAGAGGAGGC 59.183 50.000 0.0 0.0 0.00 4.70
1049 1052 7.763528 TGAAATCCAATCCACGAAATAATTTGG 59.236 33.333 0.0 0.0 0.00 3.28
1322 1325 5.324409 AGACAGAAATAAAGCATTGGGTCA 58.676 37.500 0.0 0.0 30.20 4.02
1449 1453 1.277580 AACTCAGAGCATGGGAGGGG 61.278 60.000 0.0 0.0 31.77 4.79
1456 1460 3.067320 TCGATACTGGAACTCAGAGCATG 59.933 47.826 0.0 0.0 46.18 4.06
1661 1665 2.496871 CCATGGCTGAATGGTTAAAGCA 59.503 45.455 0.0 0.0 41.98 3.91
1898 1902 9.842775 TTGCTAAAGAGAAATGATCACTATGAT 57.157 29.630 0.0 0.0 40.34 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.