Multiple sequence alignment - TraesCS3D01G499200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G499200 chr3D 100.000 2141 0 0 1 2141 589279304 589277164 0 3954
1 TraesCS3D01G499200 chr5D 99.021 2144 18 2 1 2141 503218456 503220599 0 3840
2 TraesCS3D01G499200 chr5D 98.647 2144 26 2 1 2141 503277988 503275845 0 3795
3 TraesCS3D01G499200 chr1A 99.021 2144 18 2 1 2141 554512486 554514629 0 3840
4 TraesCS3D01G499200 chr3B 98.834 2144 22 2 1 2141 201527262 201529405 0 3818
5 TraesCS3D01G499200 chr3A 98.647 2144 24 4 1 2141 672909769 672907628 0 3794
6 TraesCS3D01G499200 chr3A 98.461 2144 29 3 1 2141 594899386 594897244 0 3773
7 TraesCS3D01G499200 chr6D 98.601 2144 27 2 1 2141 168255164 168257307 0 3790


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G499200 chr3D 589277164 589279304 2140 True 3954 3954 100.000 1 2141 1 chr3D.!!$R1 2140
1 TraesCS3D01G499200 chr5D 503218456 503220599 2143 False 3840 3840 99.021 1 2141 1 chr5D.!!$F1 2140
2 TraesCS3D01G499200 chr5D 503275845 503277988 2143 True 3795 3795 98.647 1 2141 1 chr5D.!!$R1 2140
3 TraesCS3D01G499200 chr1A 554512486 554514629 2143 False 3840 3840 99.021 1 2141 1 chr1A.!!$F1 2140
4 TraesCS3D01G499200 chr3B 201527262 201529405 2143 False 3818 3818 98.834 1 2141 1 chr3B.!!$F1 2140
5 TraesCS3D01G499200 chr3A 672907628 672909769 2141 True 3794 3794 98.647 1 2141 1 chr3A.!!$R2 2140
6 TraesCS3D01G499200 chr3A 594897244 594899386 2142 True 3773 3773 98.461 1 2141 1 chr3A.!!$R1 2140
7 TraesCS3D01G499200 chr6D 168255164 168257307 2143 False 3790 3790 98.601 1 2141 1 chr6D.!!$F1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
705 709 2.224548 CCATAAATCGACTTCCCCTCCC 60.225 54.545 0.0 0.0 0.0 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1617 1622 3.739519 GCTACAAGATCTAGTGCACTGGG 60.74 52.174 29.57 20.38 0.0 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
571 574 5.359860 CCACCTTAACACCAAAGAAGAGTTT 59.640 40.000 0.00 0.00 0.00 2.66
698 702 7.496529 TTGATTCCATCCATAAATCGACTTC 57.503 36.000 0.00 0.00 33.13 3.01
705 709 2.224548 CCATAAATCGACTTCCCCTCCC 60.225 54.545 0.00 0.00 0.00 4.30
1147 1151 7.199167 TGGATCCAATTCTATTGAGTCTGAA 57.801 36.000 13.46 0.00 0.00 3.02
1297 1301 7.667575 ATAGATCCTCTTTAGCAGAAAGACA 57.332 36.000 9.16 1.65 33.20 3.41
1938 1944 4.870426 GGAACGAGCATGAAGAGATTAACA 59.130 41.667 0.00 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 301 7.763528 TGAAATCCAATCCACGAAATAATTTGG 59.236 33.333 0.00 0.00 0.00 3.28
571 574 5.324409 AGACAGAAATAAAGCATTGGGTCA 58.676 37.500 0.00 0.00 30.20 4.02
698 702 1.277580 AACTCAGAGCATGGGAGGGG 61.278 60.000 0.00 0.00 31.77 4.79
705 709 3.067320 TCGATACTGGAACTCAGAGCATG 59.933 47.826 0.00 0.00 46.18 4.06
910 914 2.496871 CCATGGCTGAATGGTTAAAGCA 59.503 45.455 0.00 0.00 41.98 3.91
1147 1151 9.842775 TTGCTAAAGAGAAATGATCACTATGAT 57.157 29.630 0.00 0.00 40.34 2.45
1500 1505 3.587061 TCTTGTGGAATAAGAAGCCCTCA 59.413 43.478 0.00 0.00 41.30 3.86
1617 1622 3.739519 GCTACAAGATCTAGTGCACTGGG 60.740 52.174 29.57 20.38 0.00 4.45
1938 1944 9.847706 GAAAAACTCAAAAGAGAAAGAAGTCTT 57.152 29.630 0.00 0.00 37.91 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.