Multiple sequence alignment - TraesCS3D01G498900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G498900 chr3D 100.000 2177 0 0 1 2177 589265768 589267944 0.000000e+00 4021
1 TraesCS3D01G498900 chr6D 99.325 2075 13 1 1 2074 389254924 389252850 0.000000e+00 3753
2 TraesCS3D01G498900 chr6D 99.179 2070 16 1 1 2069 389250129 389248060 0.000000e+00 3727
3 TraesCS3D01G498900 chr6D 99.057 106 1 0 2072 2177 389248004 389247899 7.930000e-45 191
4 TraesCS3D01G498900 chr6D 99.057 106 1 0 2072 2177 389252757 389252652 7.930000e-45 191
5 TraesCS3D01G498900 chr3A 99.229 2075 14 2 1 2074 66007377 66009450 0.000000e+00 3742
6 TraesCS3D01G498900 chr3A 98.554 2075 29 1 1 2074 672899766 672901840 0.000000e+00 3664
7 TraesCS3D01G498900 chr5D 99.133 2075 16 2 1 2074 503238781 503236708 0.000000e+00 3731
8 TraesCS3D01G498900 chr5D 99.084 2075 14 3 1 2074 503243027 503240957 0.000000e+00 3722
9 TraesCS3D01G498900 chr5D 99.057 106 1 0 2072 2177 503226298 503226193 7.930000e-45 191
10 TraesCS3D01G498900 chrUn 98.796 2076 20 3 1 2074 216508363 216510435 0.000000e+00 3690
11 TraesCS3D01G498900 chrUn 99.057 106 1 0 2072 2177 216510528 216510633 7.930000e-45 191
12 TraesCS3D01G498900 chrUn 99.057 106 1 0 2072 2177 286272855 286272750 7.930000e-45 191
13 TraesCS3D01G498900 chrUn 99.057 106 1 0 2072 2177 455551521 455551416 7.930000e-45 191
14 TraesCS3D01G498900 chr3B 98.651 2075 26 2 1 2074 201537275 201535202 0.000000e+00 3675
15 TraesCS3D01G498900 chr1D 98.602 2075 28 1 1 2074 176207495 176205421 0.000000e+00 3670
16 TraesCS3D01G498900 chr1D 99.057 106 1 0 2072 2177 51918642 51918747 7.930000e-45 191
17 TraesCS3D01G498900 chr1D 99.057 106 1 0 2072 2177 254387006 254387111 7.930000e-45 191
18 TraesCS3D01G498900 chr4D 99.057 106 1 0 2072 2177 177441363 177441468 7.930000e-45 191


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G498900 chr3D 589265768 589267944 2176 False 4021.0 4021 100.0000 1 2177 1 chr3D.!!$F1 2176
1 TraesCS3D01G498900 chr6D 389247899 389254924 7025 True 1965.5 3753 99.1545 1 2177 4 chr6D.!!$R1 2176
2 TraesCS3D01G498900 chr3A 66007377 66009450 2073 False 3742.0 3742 99.2290 1 2074 1 chr3A.!!$F1 2073
3 TraesCS3D01G498900 chr3A 672899766 672901840 2074 False 3664.0 3664 98.5540 1 2074 1 chr3A.!!$F2 2073
4 TraesCS3D01G498900 chr5D 503236708 503243027 6319 True 3726.5 3731 99.1085 1 2074 2 chr5D.!!$R2 2073
5 TraesCS3D01G498900 chrUn 216508363 216510633 2270 False 1940.5 3690 98.9265 1 2177 2 chrUn.!!$F1 2176
6 TraesCS3D01G498900 chr3B 201535202 201537275 2073 True 3675.0 3675 98.6510 1 2074 1 chr3B.!!$R1 2073
7 TraesCS3D01G498900 chr1D 176205421 176207495 2074 True 3670.0 3670 98.6020 1 2074 1 chr1D.!!$R1 2073

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
54 55 0.527565 TCTTACGCGTTACTCACCCC 59.472 55.0 20.78 0.0 0.0 4.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1511 1515 0.597637 CGTGCTTTGGTGAGTCGTCT 60.598 55.0 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 0.527565 TCTTACGCGTTACTCACCCC 59.472 55.000 20.78 0.00 0.00 4.95
545 546 1.401905 GGGCTTTCTTTCCGCACTATG 59.598 52.381 0.00 0.00 0.00 2.23
1035 1038 7.931015 AGTAATAGAAATCCATGTCCTACCA 57.069 36.000 0.00 0.00 0.00 3.25
1291 1294 4.752101 AGTTCATCACGGAAGAAAGAACTG 59.248 41.667 16.97 0.00 41.37 3.16
1452 1456 1.300697 GCTACCGCGGGTCTTATGG 60.301 63.158 31.76 10.37 37.09 2.74
1511 1515 6.471233 ACATAGGTCATCGAAAAGATCTCA 57.529 37.500 0.00 0.00 37.52 3.27
2087 11188 3.080660 AGGATCCACTATCAACCCCAT 57.919 47.619 15.82 0.00 36.20 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 0.817634 TGGTGTTTCCAGTGGCGAAG 60.818 55.000 3.51 0.00 41.93 3.79
1035 1038 8.325046 AGGATAGCAAGTTCTAAATTCTGTCTT 58.675 33.333 0.00 0.00 0.00 3.01
1412 1416 5.129815 AGCAATAGAACGGGGAAAGTATACA 59.870 40.000 5.50 0.00 0.00 2.29
1452 1456 8.402472 GGGATATCTATATGATCCGATCGATTC 58.598 40.741 18.66 13.11 40.16 2.52
1511 1515 0.597637 CGTGCTTTGGTGAGTCGTCT 60.598 55.000 0.00 0.00 0.00 4.18
2087 11188 3.181452 ACGTAAGGCAGAGTTGGGTTTTA 60.181 43.478 0.00 0.00 46.39 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.